Misplaced Pages

#525474

80-463: 4KWG , 1CW3 , 1NZW , 1NZX , 1NZZ , 1O00 , 1O01 , 1O02 , 1O04 , 1O05 , 1ZUM , 2ONM , 2ONN , 2ONO , 2ONP , 2VLE , 3INJ , 3INL , 3N80 , 3N81 , 3N82 , 3N83 , 3SZ9 , 4FQF , 4FR8 , 4KWF 217 11669 ENSG00000111275 ENSMUSG00000029455 P05091 P47738 NM_001204889 NM_000690 NM_009656 NM_001308450 NP_000681 NP_001191818 NP_001295379 NP_033786 Aldehyde dehydrogenase, mitochondrial

160-399: A CAAT -like sequence (GTCATCAT) are located 473 and 515 bp , respectively, upstream from the translation initiation codon . ALDH2 is a tetrameric enzyme that contains three domains; two dinucleotide-binding domains and a three-stranded beta-sheet domain. The active site of ALDH2 is divided into two halves by the nicotinamide ring of nicotinamide adenine dinucleotide (NAD). Adjacent to

240-487: A catalytic triad , stabilize charge build-up on the transition states using an oxyanion hole , complete hydrolysis using an oriented water substrate. Enzymes are not rigid, static structures; instead they have complex internal dynamic motions – that is, movements of parts of the enzyme's structure such as individual amino acid residues, groups of residues forming a protein loop or unit of secondary structure , or even an entire protein domain . These motions give rise to

320-489: A conformational ensemble of slightly different structures that interconvert with one another at equilibrium . Different states within this ensemble may be associated with different aspects of an enzyme's function. For example, different conformations of the enzyme dihydrofolate reductase are associated with the substrate binding, catalysis, cofactor release, and product release steps of the catalytic cycle, consistent with catalytic resonance theory . Substrate presentation

400-477: A first step and then checks that the product is correct in a second step. This two-step process results in average error rates of less than 1 error in 100 million reactions in high-fidelity mammalian polymerases. Similar proofreading mechanisms are also found in RNA polymerase , aminoacyl tRNA synthetases and ribosomes . Conversely, some enzymes display enzyme promiscuity , having broad specificity and acting on

480-519: A genetic ALDH2*2 deficiency have historically had a lower likelihood of developing alcoholism, both from stronger adverse effects and a possible reduction of dopamine release. However, this effect is not absolute: during the 1980s, there has been a steady increase in the number of Japanese alcoholics who carry the ALDH2*2 mutation. A strong social pressure to drink have overcome this genetic barrier to alcoholism . Disulfiram, which inhibits ALDH2 and causes

560-427: A number of consequences, detailed in section § Inhibition and genetic deficiency below. In the overall Japanese population, about 57% of individuals are homozygous for the normal allele, 40% are heterozygous for the ALDH2*2 allele, and 3% are homozygous for the ALDH2*2 allele. The best-known consequence of ALDH2 dysfunction is in relation to the consumption of ethanol . People heterozygous or homozygous for

640-735: A protector against oxidative stress . The inactivating ALDH2*2 mutation is "the most common single point mutation in humans". This mutation is found in very few White people, but about 50% of East Asians are heterozygous for this mutation. The ALDH2*2 allele encodes lysine instead of glutamic acid at amino acid 487, distorting the NAD+ binding site. ALDH2 assembles and functions as a tetramer and requires all four of its components to be active in order to metabolize acetaldehyde. People heterozygous for ALDH2*2 have only 10% to 45% enzyme activity, while those homozygous for ALDH2*2 have as little as 1% to 5% remaining activity. The lack of ALDH2 activity has

720-464: A quantitative theory of enzyme kinetics, which is referred to as Michaelis–Menten kinetics . The major contribution of Michaelis and Menten was to think of enzyme reactions in two stages. In the first, the substrate binds reversibly to the enzyme, forming the enzyme-substrate complex. This is sometimes called the Michaelis–Menten complex in their honor. The enzyme then catalyzes the chemical step in

800-439: A range of different physiologically relevant substrates. Many enzymes possess small side activities which arose fortuitously (i.e. neutrally ), which may be the starting point for the evolutionary selection of a new function. To explain the observed specificity of enzymes, in 1894 Emil Fischer proposed that both the enzyme and the substrate possess specific complementary geometric shapes that fit exactly into one another. This

880-610: A similar but stronger promoter structure. Both boxes are located in the left arm. Alu elements contain four or fewer Retinoic Acid response element hexamer sites in its internal promoter , with the last one overlapping with the "B box". In this 7SL ( SRP ) RNA example below, functional hexamers are underlined using a solid line, with the non-functional third hexamer denoted using a dotted line: GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGG AGGCTG AGGCTGGA GGATCG CTTG AGTCCA GG AGTTCT GGGCT GTAGTGCGCTATGCCGATCGGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCTC . The recognition sequence of

SECTION 10

#1732773316526

960-449: A similar effect, has been used as an alcohol-quitting aid. More recently, ALDH2 has been implicated in a number of pathways beyond alcohol metabolism. ALDH2 dysfunction is supposedly associated with a variety of human diseases including diabetes, neurodegenerative diseases, cardiovascular diseases and stroke, cancer, Fanconi anemia, pain, osteoporosis, and the process of aging. The inactivating ALDH2 rs671 polymorphism, present in up to 8% of

1040-451: A species' normal level; as a result, enzymes from bacteria living in volcanic environments such as hot springs are prized by industrial users for their ability to function at high temperatures, allowing enzyme-catalysed reactions to be operated at a very high rate. Enzymes are usually much larger than their substrates. Sizes range from just 62 amino acid residues, for the monomer of 4-oxalocrotonate tautomerase , to over 2,500 residues in

1120-507: A specific RNA:protein complex with a protein heterodimer consisting of SRP9 and SRP14. SRP9/14 facilitates Alu 's attachment to ribosomes that capture nascent L1 proteins . Thus, an Alu element can take control of the L1 protein's reverse transcriptase , ensuring that the Alu 's RNA sequence gets copied into the genome rather than the L1's mRNA. Alu elements in primates form a fossil record that

1200-449: A steady level inside the cell. For example, NADPH is regenerated through the pentose phosphate pathway and S -adenosylmethionine by methionine adenosyltransferase . This continuous regeneration means that small amounts of coenzymes can be used very intensively. For example, the human body turns over its own weight in ATP each day. As with all catalysts, enzymes do not alter the position of

1280-555: A sub-subfamily of AluS which included active Alu elements was given the separate name AluY. Dating back 65 million years, the AluJ lineage is the oldest and least active in the human genome. The younger AluS lineage is about 30 million years old and still contains some active elements. Finally, the AluY elements are the youngest of the three and have the greatest disposition to move along the human genome. The discovery of Alu subfamilies led to

1360-442: A thermodynamically unfavourable one so that the combined energy of the products is lower than the substrates. For example, the hydrolysis of ATP is often used to drive other chemical reactions. Enzyme kinetics is the investigation of how enzymes bind substrates and turn them into products. The rate data used in kinetic analyses are commonly obtained from enzyme assays . In 1913 Leonor Michaelis and Maud Leonora Menten proposed

1440-457: Is k cat , also called the turnover number , which is the number of substrate molecules handled by one active site per second. The efficiency of an enzyme can be expressed in terms of k cat / K m . This is also called the specificity constant and incorporates the rate constants for all steps in the reaction up to and including the first irreversible step. Because the specificity constant reflects both affinity and catalytic ability, it

1520-838: Is orotidine 5'-phosphate decarboxylase , which allows a reaction that would otherwise take millions of years to occur in milliseconds. Chemically, enzymes are like any catalyst and are not consumed in chemical reactions, nor do they alter the equilibrium of a reaction. Enzymes differ from most other catalysts by being much more specific. Enzyme activity can be affected by other molecules: inhibitors are molecules that decrease enzyme activity, and activators are molecules that increase activity. Many therapeutic drugs and poisons are enzyme inhibitors. An enzyme's activity decreases markedly outside its optimal temperature and pH , and many enzymes are (permanently) denatured when exposed to excessive heat, losing their structure and catalytic properties. Some enzymes are used commercially, for example, in

1600-421: Is a process where the enzyme is sequestered away from its substrate. Enzymes can be sequestered to the plasma membrane away from a substrate in the nucleus or cytosol. Or within the membrane, an enzyme can be sequestered into lipid rafts away from its substrate in the disordered region. When the enzyme is released it mixes with its substrate. Alternatively, the enzyme can be sequestered near its substrate to activate

1680-400: Is about 44  kbp in length and contains at least 13 exons which encode 517 amino acid residues. Except for the signal NH2-terminal peptide , which is absent in the mature enzyme, the amino acid sequence deduced from the exons coincided with the reported primary structure of human liver ALDH2. Several introns contain Alu repetitive sequences. A TATA -like sequence (TTATAAAA) and

SECTION 20

#1732773316526

1760-554: Is an enzyme that in humans is encoded by the ALDH2 gene located on chromosome 12 . ALDH2 belongs to the aldehyde dehydrogenase family of enzymes. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. ALDH2 has a low K m for acetaldehyde , and is localized in mitochondrial matrix . The other liver isozyme, ALDH1 , localizes to the cytosol . Most White people have both major isozymes, while approximately 36% of East Asians have

1840-458: Is because insertion of an Alu element occurs only 100 - 200 times per million years, and no known mechanism of deletion of one has been found. Therefore, individuals with an element likely descended from an ancestor with one—and vice versa, for those without. In genetics, the presence or lack thereof of a recently inserted Alu element may be a good property to consider when studying human evolution. Most human Alu element insertions can be found in

1920-465: Is believed modern Alu elements emerged from a head to tail fusion of two distinct FAMs (fossil antique monomers) over 100 million years ago, hence its dimeric structure of two similar, but distinct monomers (left and right arms) joined by an A-rich linker. Both monomers are thought to have evolved from 7SL, also known as SRP RNA . The length of the polyA tail varies between Alu families. There are over one million Alu elements interspersed throughout

2000-437: Is described by "EC" followed by a sequence of four numbers which represent the hierarchy of enzymatic activity (from very general to very specific). That is, the first number broadly classifies the enzyme based on its mechanism while the other digits add more and more specificity. The top-level classification is: These sections are subdivided by other features such as the substrate, products, and chemical mechanism . An enzyme

2080-749: Is fully specified by four numerical designations. For example, hexokinase (EC 2.7.1.1) is a transferase (EC 2) that adds a phosphate group (EC 2.7) to a hexose sugar, a molecule containing an alcohol group (EC 2.7.1). Sequence similarity . EC categories do not reflect sequence similarity. For instance, two ligases of the same EC number that catalyze exactly the same reaction can have completely different sequences. Independent of their function, enzymes, like any other proteins, have been classified by their sequence similarity into numerous families. These families have been documented in dozens of different protein and protein family databases such as Pfam . Non-homologous isofunctional enzymes . Unrelated enzymes that have

2160-476: Is often derived from its substrate or the chemical reaction it catalyzes, with the word ending in -ase . Examples are lactase , alcohol dehydrogenase and DNA polymerase . Different enzymes that catalyze the same chemical reaction are called isozymes . The International Union of Biochemistry and Molecular Biology have developed a nomenclature for enzymes, the EC numbers (for "Enzyme Commission") . Each enzyme

2240-418: Is often referred to as "the lock and key" model. This early model explains enzyme specificity, but fails to explain the stabilization of the transition state that enzymes achieve. In 1958, Daniel Koshland suggested a modification to the lock and key model: since enzymes are rather flexible structures, the active site is continuously reshaped by interactions with the substrate as the substrate interacts with

2320-462: Is only one of several important kinetic parameters. The amount of substrate needed to achieve a given rate of reaction is also important. This is given by the Michaelis–Menten constant ( K m ), which is the substrate concentration required for an enzyme to reach one-half its maximum reaction rate; generally, each enzyme has a characteristic K M for a given substrate. Another useful constant

2400-409: Is relatively easy to decipher because Alu element insertion events have a characteristic signature that is both easy to read and faithfully recorded in the genome from generation to generation. The study of Alu Y elements (the more recently evolved) thus reveals details of ancestry because individuals will most likely only share a particular Alu element insertion if they have a common ancestor. This

2480-404: Is seen. This is shown in the saturation curve on the right. Saturation happens because, as substrate concentration increases, more and more of the free enzyme is converted into the substrate-bound ES complex. At the maximum reaction rate ( V max ) of the enzyme, all the enzyme active sites are bound to substrate, and the amount of ES complex is the same as the total amount of enzyme. V max

ALDH2 - Misplaced Pages Continue

2560-403: Is the ribosome which is a complex of protein and catalytic RNA components. Enzymes must bind their substrates before they can catalyse any chemical reaction. Enzymes are usually very specific as to what substrates they bind and then the chemical reaction catalysed. Specificity is achieved by binding pockets with complementary shape, charge and hydrophilic / hydrophobic characteristics to

2640-559: Is the fossil Alu monomer (FAM). Free-floating forms of the left and right arms exist, termed free left Alu monomers (FLAMs) and free right Alu monomers (FRAMs) respectively. A notable FLAM in primates is the BC200 lncRNA . Two main promoter "boxes" are found in Alu: a 5' A box with the consensus TGGCTCACGCC , and a 3' B box with the consensus GTTCGAGAC (IUPAC nucleic acid notation ). tRNAs , which are transcribed by RNA polymerase III , have

2720-790: Is useful for comparing different enzymes against each other, or the same enzyme with different substrates. The theoretical maximum for the specificity constant is called the diffusion limit and is about 10 to 10 (M s ). At this point every collision of the enzyme with its substrate will result in catalysis, and the rate of product formation is not limited by the reaction rate but by the diffusion rate. Enzymes with this property are called catalytically perfect or kinetically perfect . Example of such enzymes are triose-phosphate isomerase , carbonic anhydrase , acetylcholinesterase , catalase , fumarase , β-lactamase , and superoxide dismutase . The turnover of such enzymes can reach several million reactions per second. But most enzymes are far from perfect:

2800-916: The Alu I endonuclease is 5' ag/ct 3'; that is, the enzyme cuts the DNA segment between the guanine and cytosine residues (in lowercase above). Alu elements are responsible for regulation of tissue-specific genes. They are also involved in the transcription of nearby genes and can sometimes change the way a gene is expressed. Alu elements are retrotransposons and look like DNA copies made from RNA polymerase III -encoded RNAs. Alu elements do not encode for protein products. They are replicated as any other DNA sequence, but depend on LINE retrotransposons for generation of new elements. Alu element replication and mobilization begins by interactions with signal recognition particles (SRPs), which aid newly translated proteins to reach their final destinations. Alu RNA forms

2880-614: The DNA polymerases ; here the holoenzyme is the complete complex containing all the subunits needed for activity. Coenzymes are small organic molecules that can be loosely or tightly bound to an enzyme. Coenzymes transport chemical groups from one enzyme to another. Examples include NADH , NADPH and adenosine triphosphate (ATP). Some coenzymes, such as flavin mononucleotide (FMN), flavin adenine dinucleotide (FAD), thiamine pyrophosphate (TPP), and tetrahydrofolate (THF), are derived from vitamins . These coenzymes cannot be synthesized by

2960-512: The evolution of humans . The Alu family is a family of repetitive elements in primate genomes, including the human genome . Modern Alu elements are about 300 base pairs long and are therefore classified as short interspersed nuclear elements (SINEs) among the class of repetitive RNA elements. The typical structure is 5' - Part A - A5TACA6 - Part B - PolyA Tail - 3', where Part A and Part B (also known as "left arm" and "right arm") are similar nucleotide sequences. Expressed another way, it

3040-511: The law of mass action , which is derived from the assumptions of free diffusion and thermodynamically driven random collision. Many biochemical or cellular processes deviate significantly from these conditions, because of macromolecular crowding and constrained molecular movement. More recent, complex extensions of the model attempt to correct for these effects. Enzyme reaction rates can be decreased by various types of enzyme inhibitors. A competitive inhibitor and substrate cannot bind to

3120-522: The A-side ( Pro -R) of the nicotinamide ring is a cluster of three cysteines (Cys301, Cys302 and Cys303) and adjacent to the B-side (Pro-S) are Thr 244, Glu 268, Glu476 and an ordered water molecule bound to Thr244 and Glu476. Although there is a recognizable Rossmann fold , the coenzyme-binding region of ALDH2 binds NAD in a manner not seen in other NAD-binding enzymes. The positions of the residues near

3200-567: The ALDH2*2 metabolize ethanol to acetaldehyde normally but metabolize acetaldehyde poorly. As a result, they accumulate increased levels of acetaldehyde after consumption of alcoholic beverages . Effects include facial flushing (i.e. the " Alcohol flush reaction "), urticaria , systemic dermatitis , and alcohol-induced respiratory reactions such as rhinitis and the exacerbation of asthma bronchoconstriction . The cited allergic reaction-like symptoms: (a) do not appear due to classical IgE or T cell -related allergen -induced reactions but rather

3280-400: The ability to carry out biological catalysis, which is often reflected in their amino acid sequences and unusual 'pseudocatalytic' properties. Enzymes are known to catalyze more than 5,000 biochemical reaction types. Other biocatalysts are catalytic RNA molecules , also called ribozymes . They are sometimes described as a type of enzyme rather than being like an enzyme, but even in

ALDH2 - Misplaced Pages Continue

3360-446: The actions of acetaldehyde in stimulating the release of histamine , a probable mediating cause of these symptoms; (b) typically occur within 30–60 minutes of ingesting alcoholic beverages; and (c) occur in other Asian as well as non-Asian individuals that are either seriously defective in metabolizing ingested ethanol past acetaldehyde to acetic acid or, alternatively, that metabolize ethanol too rapidly for ALDH2 processing. People with

3440-437: The active site and are involved in catalysis. For example, flavin and heme cofactors are often involved in redox reactions. Enzymes that require a cofactor but do not have one bound are called apoenzymes or apoproteins . An enzyme together with the cofactor(s) required for activity is called a holoenzyme (or haloenzyme). The term holoenzyme can also be applied to enzymes that contain multiple protein subunits, such as

3520-502: The active site. Organic cofactors can be either coenzymes , which are released from the enzyme's active site during the reaction, or prosthetic groups , which are tightly bound to an enzyme. Organic prosthetic groups can be covalently bound (e.g., biotin in enzymes such as pyruvate carboxylase ). An example of an enzyme that contains a cofactor is carbonic anhydrase , which uses a zinc cofactor bound as part of its active site. These tightly bound ions or molecules are usually found in

3600-407: The animal fatty acid synthase . Only a small portion of their structure (around 2–4 amino acids) is directly involved in catalysis: the catalytic site. This catalytic site is located next to one or more binding sites where residues orient the substrates. The catalytic site and binding site together compose the enzyme's active site . The remaining majority of the enzyme structure serves to maintain

3680-578: The average values of k c a t / K m {\displaystyle k_{\rm {cat}}/K_{\rm {m}}} and k c a t {\displaystyle k_{\rm {cat}}} are about 10 5 s − 1 M − 1 {\displaystyle 10^{5}{\rm {s}}^{-1}{\rm {M}}^{-1}} and 10 s − 1 {\displaystyle 10{\rm {s}}^{-1}} , respectively. Michaelis–Menten kinetics relies on

3760-502: The body de novo and closely related compounds (vitamins) must be acquired from the diet. The chemical groups carried include: Since coenzymes are chemically changed as a consequence of enzyme action, it is useful to consider coenzymes to be a special class of substrates, or second substrates, which are common to many different enzymes. For example, about 1000 enzymes are known to use the coenzyme NADH. Coenzymes are usually continuously regenerated and their concentrations maintained at

3840-471: The chemical equilibrium of the reaction. In the presence of an enzyme, the reaction runs in the same direction as it would without the enzyme, just more quickly. For example, carbonic anhydrase catalyzes its reaction in either direction depending on the concentration of its reactants: The rate of a reaction is dependent on the activation energy needed to form the transition state which then decays into products. Enzymes increase reaction rates by lowering

3920-425: The conversion of starch to sugars by plant extracts and saliva were known but the mechanisms by which these occurred had not been identified. French chemist Anselme Payen was the first to discover an enzyme, diastase , in 1833. A few decades later, when studying the fermentation of sugar to alcohol by yeast , Louis Pasteur concluded that this fermentation was caused by a vital force contained within

4000-425: The corresponding positions in the genomes of other primates, but about 7,000 Alu insertions are unique to humans. Alu elements have been proposed to affect gene expression and been found to contain functional promoter regions for steroid hormone receptors . Due to the abundant content of CpG dinucleotides found in Alu elements, these regions serve as a site of methylation , contributing to up to 30% of

4080-415: The cytosolic isozyme but not a functional mitochondrial isozyme. A remarkably higher frequency of acute alcohol intoxication among East Asians than among Whites could be related to this absence of a catalytically active form of ALDH2. The increased exposure to acetaldehyde in individuals with the catalytically inactive form may also confer greater susceptibility to many types of cancer . The ALDH2 gene

SECTION 50

#1732773316526

4160-444: The decades since ribozymes' discovery in 1980–1982, the word enzyme alone often means the protein type specifically (as is used in this article). An enzyme's specificity comes from its unique three-dimensional structure . Like all catalysts, enzymes increase the reaction rate by lowering its activation energy . Some enzymes can make their conversion of substrate to product occur many millions of times faster. An extreme example

4240-513: The disease so the presence of a particular Alu allele does not mean that the carrier will definitely get the disease. The first report of Alu -mediated recombination causing a prevalent inherited predisposition to cancer was a 1995 report about hereditary nonpolyposis colorectal cancer . In the human genome, the most recently active have been the 22 AluY and 6 AluS Transposon Element subfamilies due to their inherited activity to cause various cancers. Thus due to their major heritable damage it

4320-433: The energy of the transition state. First, binding forms a low energy enzyme-substrate complex (ES). Second, the enzyme stabilises the transition state such that it requires less energy to achieve compared to the uncatalyzed reaction (ES ). Finally the enzyme-product complex (EP) dissociates to release the products. Enzymes can couple two or more reactions, so that a thermodynamically favorable reaction can be used to "drive"

4400-592: The enzyme urease was a pure protein and crystallized it; he did likewise for the enzyme catalase in 1937. The conclusion that pure proteins can be enzymes was definitively demonstrated by John Howard Northrop and Wendell Meredith Stanley , who worked on the digestive enzymes pepsin (1930), trypsin and chymotrypsin . These three scientists were awarded the 1946 Nobel Prize in Chemistry. The discovery that enzymes could be crystallized eventually allowed their structures to be solved by x-ray crystallography . This

4480-483: The enzyme at the same time. Often competitive inhibitors strongly resemble the real substrate of the enzyme. For example, the drug methotrexate is a competitive inhibitor of the enzyme dihydrofolate reductase , which catalyzes the reduction of dihydrofolate to tetrahydrofolate. The similarity between the structures of dihydrofolate and this drug are shown in the accompanying figure. This type of inhibition can be overcome with high substrate concentration. In some cases,

4560-422: The enzyme converts the substrates into different molecules known as products . Almost all metabolic processes in the cell need enzyme catalysis in order to occur at rates fast enough to sustain life. Metabolic pathways depend upon enzymes to catalyze individual steps. The study of enzymes is called enzymology and the field of pseudoenzyme analysis recognizes that during evolution, some enzymes have lost

4640-403: The enzyme. As a result, the substrate does not simply bind to a rigid active site; the amino acid side-chains that make up the active site are molded into the precise positions that enable the enzyme to perform its catalytic function. In some cases, such as glycosidases , the substrate molecule also changes shape slightly as it enters the active site. The active site continues to change until

4720-427: The enzyme. For example, the enzyme can be soluble and upon activation bind to a lipid in the plasma membrane and then act upon molecules in the plasma membrane. Allosteric sites are pockets on the enzyme, distinct from the active site, that bind to molecules in the cellular environment. These molecules then cause a change in the conformation or dynamics of the enzyme that is transduced to the active site and thus affects

4800-1459: The global population and in up to 50% of the East Asian population, is associated with increased risk of cardiovascular conditions such as coronary artery disease, alcohol-induced cardiac dysfunction, pulmonary arterial hypertension, heart failure and drug-induced cardiotoxicity. A case-control study in a Japanese population showed that deficiency of ALDH2 activity influences the risk for late-onset Alzheimer's disease . The ALDH2 knockout mice display age-related memory deficits in various tasks, as well as endothelial dysfunction, brain atrophy, and other Alzheimer's disease-associated pathologies, including marked increases in lipid peroxidation products, amyloid-beta , p-tau and activated caspases . These behavioral and biochemical Alzheimer's disease-like deficits were efficiently ameliorated when these mice were treated with isotope-reinforced lipids (deuterated polyunsaturated fatty acids). An activator of ALDH2 enzymatic activity, Alda-1 (N-(1,3-benzodioxol-5-ylmethyl)-2,6-dichlorobenzamide), has been shown to reduce ischemia -induced cardiac damage caused by myocardial infarction . ALDH2 has been shown to interact with GroEL . Enzyme Enzymes ( / ˈ ɛ n z aɪ m z / ) are proteins that act as biological catalysts by accelerating chemical reactions . The molecules upon which enzymes may act are called substrates , and

4880-608: The human body are inserted into coding regions ( exons ) or into mRNA after the process of splicing. However, the variation generated can be used in studies of the movement and ancestry of human populations, and the mutagenic effect of Alu and retrotransposons in general has played a major role in the evolution of the human genome. There are also a number of cases where Alu insertions or deletions are associated with specific effects in humans: Alu insertions are sometimes disruptive and can result in inherited disorders. However, most Alu variation acts as markers that segregate with

SECTION 60

#1732773316526

4960-460: The human genome, and it is estimated that about 10.7% of the human genome consists of Alu sequences. However, less than 0.5% are polymorphic (i.e., occurring in more than one form or morph). In 1988, Jerzy Jurka and Temple Smith discovered that Alu elements were split in two major subfamilies known as AluJ (named after Jurka) and AluS (named after Smith), and other Alu subfamilies were also independently discovered by several groups. Later on,

5040-554: The hypothesis of master/source genes, and provided the definitive link between transposable elements (active elements) and interspersed repetitive DNA (mutated copies of active elements). B1 elements in rats and mice are similar to Alus in that they also evolved from 7SL RNA, but they only have one left monomer arm. 95% percent of human Alus are also found in chimpanzees, and 50% of B elements in mice are also found in rats. These elements are mostly found in introns and upstream regulatory elements of genes. The ancestral form of Alu and B1

5120-433: The inhibitor can bind to a site other than the binding-site of the usual substrate and exert an allosteric effect to change the shape of the usual binding-site. Alu element Alu insertions have been implicated in several inherited human diseases and in various forms of cancer. The study of Alu elements has also been important in elucidating human population genetics and the evolution of primates , including

5200-485: The methylation sites in the human genome. Alu elements are also a common source of mutations in humans; however, such mutations are often confined to non-coding regions of pre-mRNA ( introns ), where they have little discernible impact on the bearer. Mutations in the introns (or non-coding regions of RNA) have little or no effect on phenotype of an individual if the coding portion of individual's genome does not contain mutations. The Alu insertions that can be detrimental to

5280-474: The mixture. He named the enzyme that brought about the fermentation of sucrose " zymase ". In 1907, he received the Nobel Prize in Chemistry for "his discovery of cell-free fermentation". Following Buchner's example, enzymes are usually named according to the reaction they carry out: the suffix -ase is combined with the name of the substrate (e.g., lactase is the enzyme that cleaves lactose ) or to

5360-439: The nicotinamide ring of NAD suggest a chemical mechanism whereby Glu268 functions as a general base through a bound water molecule. The sidechain amide nitrogen of Asn 169 and the peptide nitrogen of Cys302 are in position to stabilize the oxyanion present in the tetrahedral transition state prior to hydride transfer. The functional importance of residue Glu487 now appears to be due to indirect interactions of this residue with

5440-528: The precise orientation and dynamics of the active site. In some enzymes, no amino acids are directly involved in catalysis; instead, the enzyme contains sites to bind and orient catalytic cofactors . Enzyme structures may also contain allosteric sites where the binding of a small molecule causes a conformational change that increases or decreases activity. A small number of RNA -based biological catalysts called ribozymes exist, which again can act alone or in complex with proteins. The most common of these

5520-406: The reaction and releases the product. This work was further developed by G. E. Briggs and J. B. S. Haldane , who derived kinetic equations that are still widely used today. Enzyme rates depend on solution conditions and substrate concentration . To find the maximum speed of an enzymatic reaction, the substrate concentration is increased until a constant rate of product formation

5600-733: The reaction rate of the enzyme. In this way, allosteric interactions can either inhibit or activate enzymes. Allosteric interactions with metabolites upstream or downstream in an enzyme's metabolic pathway cause feedback regulation, altering the activity of the enzyme according to the flux through the rest of the pathway. Some enzymes do not need additional components to show full activity. Others require non-protein molecules called cofactors to be bound for activity. Cofactors can be either inorganic (e.g., metal ions and iron–sulfur clusters ) or organic compounds (e.g., flavin and heme ). These cofactors serve many purposes; for instance, metal ions can help in stabilizing nucleophilic species within

5680-410: The same enzymatic activity have been called non-homologous isofunctional enzymes . Horizontal gene transfer may spread these genes to unrelated species, especially bacteria where they can replace endogenous genes of the same function, leading to hon-homologous gene displacement. Enzymes are generally globular proteins , acting alone or in larger complexes . The sequence of the amino acids specifies

5760-412: The structure which in turn determines the catalytic activity of the enzyme. Although structure determines function, a novel enzymatic activity cannot yet be predicted from structure alone. Enzyme structures unfold ( denature ) when heated or exposed to chemical denaturants and this disruption to the structure typically causes a loss of activity. Enzyme denaturation is normally linked to temperatures above

5840-519: The substrate is completely bound, at which point the final shape and charge distribution is determined. Induced fit may enhance the fidelity of molecular recognition in the presence of competition and noise via the conformational proofreading mechanism. Enzymes can accelerate reactions in several ways, all of which lower the activation energy (ΔG , Gibbs free energy ) Enzymes may use several of these mechanisms simultaneously. For example, proteases such as trypsin perform covalent catalysis using

5920-432: The substrate-binding site via Arg 264 and Arg475. Mitochondrial aldehyde dehydrogenase belongs to the aldehyde dehydrogenase family of enzymes that catalyze the chemical transformation from acetaldehyde to acetic acid . Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. Human ALDH2 is especially efficient on acetaldehyde compared to ALDH1. Additionally, ALDH2 functions as

6000-405: The substrates. Enzymes can therefore distinguish between very similar substrate molecules to be chemoselective , regioselective and stereospecific . Some of the enzymes showing the highest specificity and accuracy are involved in the copying and expression of the genome . Some of these enzymes have " proof-reading " mechanisms. Here, an enzyme such as DNA polymerase catalyzes a reaction in

6080-399: The synthesis of antibiotics . Some household products use enzymes to speed up chemical reactions: enzymes in biological washing powders break down protein, starch or fat stains on clothes, and enzymes in meat tenderizer break down proteins into smaller molecules, making the meat easier to chew. By the late 17th and early 18th centuries, the digestion of meat by stomach secretions and

6160-438: The type of reaction (e.g., DNA polymerase forms DNA polymers). The biochemical identity of enzymes was still unknown in the early 1900s. Many scientists observed that enzymatic activity was associated with proteins, but others (such as Nobel laureate Richard Willstätter ) argued that proteins were merely carriers for the true enzymes and that proteins per se were incapable of catalysis. In 1926, James B. Sumner showed that

6240-486: The yeast cells called "ferments", which were thought to function only within living organisms. He wrote that "alcoholic fermentation is an act correlated with the life and organization of the yeast cells, not with the death or putrefaction of the cells." In 1877, German physiologist Wilhelm Kühne (1837–1900) first used the term enzyme , which comes from Ancient Greek ἔνζυμον (énzymon)  ' leavened , in yeast', to describe this process. The word enzyme

6320-581: Was first done for lysozyme , an enzyme found in tears, saliva and egg whites that digests the coating of some bacteria; the structure was solved by a group led by David Chilton Phillips and published in 1965. This high-resolution structure of lysozyme marked the beginning of the field of structural biology and the effort to understand how enzymes work at an atomic level of detail. Enzymes can be classified by two main criteria: either amino acid sequence similarity (and thus evolutionary relationship) or enzymatic activity. Enzyme activity . An enzyme's name

6400-457: Was used later to refer to nonliving substances such as pepsin , and the word ferment was used to refer to chemical activity produced by living organisms. Eduard Buchner submitted his first paper on the study of yeast extracts in 1897. In a series of experiments at the University of Berlin , he found that sugar was fermented by yeast extracts even when there were no living yeast cells in

#525474