Misplaced Pages

#391608

71-668: It is also a historical term for the protein now called elongation factor G , due to its function in moving the transfer RNA (tRNA) and messenger RNA (mRNA) through the ribosome . The enzyme classification and nomenclature list was first approved by the International Union of Biochemistry in 1961. Six enzyme classes had been recognized based on the type of chemical reaction catalyzed, including oxidoreductases (EC 1), transferases (EC 2), hydrolases (EC 3), lyases (EC 4), isomerases (EC 5) and ligases (EC 6). However, it became apparent that none of these could describe

142-542: A GTPase , EF-G catalyzes the movement (translocation) of transfer RNA (tRNA) and messenger RNA (mRNA) through the ribosome . Encoded by the fusA gene on the str operon, EF-G is made up of 704 amino acids that form 5 domains , labeled Domain I through Domain V. Domain I may be referred to as the G-domain or as Domain I(G), since it binds to and hydrolyzes guanosine triphosphate (GTP). Domain I also helps EF-G bind to

213-452: A stop codon appears on the mRNA. A Class I release factor (RF1 or RF2) binds to the stop codon, which induces hydrolysis of the tRNA-peptide bond in the P site, allowing the newly-formed protein to exit the ribosome. The nascent peptide continues to fold and leaves the 70S ribosome, the mRNA, the deacylated tRNA (P site), and the Class I release factor (A site). In a GTP-dependent manner,

284-602: A 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within

355-453: A compound. It covalently links an amino acid to the CCA 3′ end of a tRNA molecule. Each tRNA is aminoacylated (or charged ) with a specific amino acid by an aminoacyl tRNA synthetase . There is normally a single aminoacyl tRNA synthetase for each amino acid, despite the fact that there can be more than one tRNA, and more than one anticodon for an amino acid. Recognition of the appropriate tRNA by

426-413: A genomically recoded E. coli strain. In eukaryotic cells, tRNAs are transcribed by RNA polymerase III as pre-tRNAs in the nucleus. RNA polymerase III recognizes two highly conserved downstream promoter sequences: the 5′ intragenic control region (5′-ICR, D-control region, or A box), and the 3′-ICR (T-control region or B box) inside tRNA genes. The first promoter begins at +8 of mature tRNAs and

497-558: A large conformational change within EF-G, forcing the A/P tRNA to fully occupy the P site, the P/E tRNA to fully occupy the E site (and exit the ribosome complex), and the mRNA to shift three nucleotides down relative to the ribosome. The GDP-bound EF-G molecule then dissociates from the complex, leaving another free A-site where the elongation cycle can start again. Protein elongation continues until

568-416: A new enzyme class (EC) of translocases (EC 7). The reaction most translocases catalyse is: A clear example of an enzyme that follows this scheme is H+-transporting two-sector ATPase: This ATPase carries out the dephosphorylation of ATP into ADP while it transports H to the other side of the membrane. However, other enzymes that also fall into this category do not follow the same reaction scheme. This

639-528: A possible role of these codons—and consequently of these tRNA modifications—in translation efficiency. Many species have lost specific tRNAs during evolution. For instance, both mammals and birds lack the same 14 out of the possible 64 tRNA genes, but other life forms contain these tRNAs. For translating codons for which an exactly pairing tRNA is missing, organisms resort to a strategy called wobbling , in which imperfectly matched tRNA/mRNA pairs still give rise to translation, although this strategy also increases

710-428: A replicator ribozyme molecule in the very early development of life, or abiogenesis . Evolution of type I and type II tRNAs is explained to the last nucleotide by the three 31 nucleotide minihelix tRNA evolution theorem, which also describes the pre-life to life transition on Earth. Three 31 nucleotide minihelices of known sequence were ligated in pre-life to generate a 93 nucleotide tRNA precursor. In pre-life,

781-416: A ribonucleoprotein world ( RNP world ). This proposed scenario is called genomic tag hypothesis . In fact, tRNA and tRNA-like aggregates have an important catalytic influence (i.e., as ribozymes ) on replication still today. These roles may be regarded as ' molecular (or chemical) fossils ' of RNA world. In March 2021, researchers reported evidence suggesting that an early form of transfer RNA could have been

SECTION 10

#1732801250392

852-575: A role in RNA interference , specifically in the suppression of retroviruses and retrotransposons that use tRNA as a primer for replication. Half-tRNAs cleaved by angiogenin are also known as tiRNAs. The biogenesis of smaller fragments, including those that function as piRNAs , are less understood. tRFs have multiple dependencies and roles; such as exhibiting significant changes between sexes, among races and disease status. Functionally, they can be loaded on Ago and act through RNAi pathways, participate in

923-439: A three-nucleotide anticodon in tRNA. As such, tRNAs are a necessary component of translation , the biological synthesis of new proteins in accordance with the genetic code. The process of translation starts with the information stored in the nucleotide sequence of DNA . This is first transformed into mRNA, then tRNA specifies which three-nucleotide codon from the genetic code corresponds to which amino acid. Each mRNA codon

994-546: Is a differentiating feature of genomes among biological domains of life: Archaea present the simplest situation in terms of genomic tRNA content with a uniform number of gene copies, Bacteria have an intermediate situation and Eukarya present the most complex situation. Eukarya present not only more tRNA gene content than the other two kingdoms but also a high variation in gene copy number among different isoacceptors, and this complexity seem to be due to duplications of tRNA genes and changes in anticodon specificity . Evolution of

1065-417: Is an adaptor molecule composed of RNA , typically 76 to 90 nucleotides in length (in eukaryotes). In a cell , it provides the physical link between the genetic code in messenger RNA (mRNA) and the amino acid sequence of proteins, carrying the correct sequence of amino acids to be combined by the protein-synthesizing machinery, the ribosome . Each three-nucleotide codon in mRNA is complemented by

1136-454: Is classified under active membrane transport , an energy-requiring process of pumping molecules and ions across membranes against a concentration gradient. Translocases biological importance relies primarily on their critical function, in the way that they provide movement across the cell's membrane in many cellular processes that are substantial, such as: The enzyme subclasses designate the types of components that are being transferred, and

1207-573: Is complete, the first aminoacyl tRNA is located in the P/P site, ready for the elongation cycle described below. During translation elongation, tRNA first binds to the ribosome as part of a complex with elongation factor Tu ( EF-Tu ) or its eukaryotic ( eEF-1 ) or archaeal counterpart. This initial tRNA binding site is called the A/T site. In the A/T site, the A-site half resides in the small ribosomal subunit where

1278-420: Is important for recognition and precise splicing of tRNA intron by endonucleases. This motif position and structure are evolutionarily conserved. However, some organisms, such as unicellular algae have a non-canonical position of BHB-motif as well as 5′- and 3′-ends of the spliced intron sequence. The 5′ sequence is removed by RNase P , whereas the 3′ end is removed by the tRNase Z enzyme. A notable exception

1349-426: Is in the archaeon Nanoarchaeum equitans , which does not possess an RNase P enzyme and has a promoter placed such that transcription starts at the 5′ end of the mature tRNA. The non-templated 3′ CCA tail is added by a nucleotidyl transferase . Before tRNAs are exported into the cytoplasm by Los1/ Xpo-t , tRNAs are aminoacylated . The order of the processing events is not conserved. For example, in yeast ,

1420-451: Is often very dependent on specific tRNA molecules. For instance, for liver cancer charging tRNA-Lys-CUU with lysine sustains liver cancer cell growth and metastasis, whereas healthy cells have a much lower dependence on this tRNA to support cellular physiology. Similarly, hepatitis E virus requires a tRNA landscape that substantially differs from that associated with uninfected cells. Hence, inhibition of aminoacylation of specific tRNA species

1491-490: Is recognized by a particular type of tRNA, which docks to it along a three-nucleotide anticodon , and together they form three complementary base pairs . On the other end of the tRNA is a covalent attachment to the amino acid corresponding to the anticodon sequence, with each type of tRNA attaching to a specific amino acid. Because the genetic code contains multiple codons that specify the same amino acid, there are several tRNA molecules bearing different anticodons which carry

SECTION 20

#1732801250392

1562-571: Is responsible for binding tightly to the ribosome. However, super-domain II will undergo a large rotational motion from the pre-translocational (PRE) state to the post-translocational (POST) state. Super-domain I is similar to the corresponding sections of EF-Tu . Super-domain II in the POST state mimics the tRNA molecule of the EF-Tu • GTP • aa-tRNA ternary complex . L7/L12 is only a multicopy protein on

1633-451: Is the case of ascorbate ferrireductase : In which the enzyme only transports an electron in the catalysation of an oxidoreductase reaction between a molecule and an inorganic cation located on different sides of the membrane. The basic function, as already mentioned (see: Translocase § Definition ), is to "catalyse the movement of ions or molecules across membranes or their separation within membranes". This form of membrane transport

1704-584: Is what necessitates codon optimization. The top half of tRNA (consisting of the T arm and the acceptor stem with 5′-terminal phosphate group and 3′-terminal CCA group) and the bottom half (consisting of the D arm and the anticodon arm) are independent units in structure as well as in function. The top half may have evolved first including the 3′-terminal genomic tag which originally may have marked tRNA-like molecules for replication in early RNA world . The bottom half may have evolved later as an expansion, e.g. as protein synthesis started in RNA world and turned it into

1775-487: The MELAS syndrome . Regions in nuclear chromosomes , very similar in sequence to mitochondrial tRNA genes, have also been identified (tRNA-lookalikes). These tRNA-lookalikes are also considered part of the nuclear mitochondrial DNA (genes transferred from the mitochondria to the nucleus). The phenomenon of multiple nuclear copies of mitochondrial tRNA (tRNA-lookalikes) has been observed in many higher organisms from human to

1846-522: The large ribosomal subunit of the bacterial ribosome that binds to certain GTPases, like Initiation Factor 2 , Elongation factor-Tu , Release Factor 3, and EF-G. Specifically, the C-terminal of L7/L12 will bind to EF-G and is necessary for GTP hydrolysis. The GTPase Associated Center (GAC) is a region on the large ribosomal subunit that consists of two smaller regions of 23S ribosomal RNA called

1917-418: The peptidyl transferase center (PTC) has catalyzed the formation of a peptide bond between amino acids, moving the polypeptide chain from the P site tRNA to the A site tRNA. The 50S and 30S ribosomal subunits are now allowed to rotate relative to each other by approximately 7°. The subunit rotation is coupled with the movement of the 3' ends of both tRNA molecules on the large subunit from the A and P sites to

1988-581: The spd group of bacteria that have elongation factors spdEFG1 and spdEFG2. From spdEFG1 and spdEFG2 evolved the mitochondrial elongation factors mtEFG1 ( GFM1 ) and mtEFG2 ( GFM2 ), respectively. The two roles of EF-G in elongation and termination of protein translation are split amongst the mitochondrial elongation factors, with mtEFG1 responsible for translocation and mtEFG2 responsible for termination and ribosomal recycling with mitochondrial RRF . Transfer RNA Transfer RNA (abbreviated tRNA and formerly referred to as sRNA , for soluble RNA )

2059-602: The 3D L-shaped structure through coaxial stacking of the helices, which is a common RNA tertiary structure motif. The lengths of each arm, as well as the loop 'diameter', in a tRNA molecule vary from species to species. The tRNA structure consists of the following: An anticodon is a unit of three nucleotides corresponding to the three bases of an mRNA codon . Each tRNA has a distinct anticodon triplet sequence that can form 3 complementary base pairs to one or more codons for an amino acid. Some anticodons pair with more than one codon due to wobble base pairing . Frequently,

2130-604: The L11 stalk and the sarcin-ricin loop (SRL). As a highly conserved rRNA loop in evolution, the SRL is critical in helping GTPases bind to the ribosome, but is not essential for GTP hydrolysis. There is some evidence to support that a phosphate oxygen in the A2662 residue of the SRL may help hydrolyze GTP. EF-G catalyzes the translocation of the tRNA and mRNA down the ribosome at the end of each round of polypeptide elongation. In this process,

2201-436: The P and E sites, respectively, while the anticodon loops remain unshifted. This rotated ribosomal intermediate, in which the first tRNA occupies a hybrid A/P position and the second tRNA occupies a hybrid P/E position is a substrate for EF-G-GTP. As a GTPase , EF-G binds to the rotated ribosome near the A site in its GTP-bound state, and hydrolyzes GTP, releasing GDP and inorganic phosphate: The hydrolysis of GTP allows for

Translocase - Misplaced Pages Continue

2272-499: The P/P and E/E sites. Once the A/A and P/P tRNAs have moved to the P/P and E/E sites, the mRNA has also moved over by one codon and the A/T site is vacant, ready for the next round of mRNA decoding. The tRNA bound in the E/E site then leaves the ribosome. The P/I site is actually the first to bind to aminoacyl tRNA, which is delivered by an initiation factor called IF2 in bacteria. However,

2343-590: The T loop evolved to interact with the D loop at the tRNA “elbow” (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth. tRNA-derived fragments (or tRFs) are short molecules that emerge after cleavage of the mature tRNAs or the precursor transcript. Both cytoplasmic and mitochondrial tRNAs can produce fragments. There are at least four structural types of tRFs believed to originate from mature tRNAs, including

2414-600: The T site (named elongation factor Tu ) and I site (initiation). By convention, the tRNA binding sites are denoted with the site on the small ribosomal subunit listed first and the site on the large ribosomal subunit listed second. For example, the A site is often written A/A, the P site, P/P, and the E site, E/E. The binding proteins like L27, L2, L14, L15, L16 at the A- and P- sites have been determined by affinity labeling by A. P. Czernilofsky et al. ( Proc. Natl. Acad. Sci, USA , pp. 230–234, 1974). Once translation initiation

2485-431: The acid side chain of the glutamate to the amide, forming the correctly charged gln-tRNA-Gln. The ribosome has three binding sites for tRNA molecules that span the space between the two ribosomal subunits : the A (aminoacyl) , P (peptidyl) , and E (exit) sites . In addition, the ribosome has two other sites for tRNA binding that are used during mRNA decoding or during the initiation of protein synthesis . These are

2556-866: The existence of the P/I site in eukaryotic or archaeal ribosomes has not yet been confirmed. The P-site protein L27 has been determined by affinity labeling by E. Collatz and A. P. Czernilofsky ( FEBS Lett. , Vol. 63, pp. 283–286, 1976). Organisms vary in the number of tRNA genes in their genome . For example, the nematode worm C. elegans , a commonly used model organism in genetics studies, has 29,647 genes in its nuclear genome, of which 620 code for tRNA. The budding yeast Saccharomyces cerevisiae has 275 tRNA genes in its genome. The number of tRNA genes per genome can vary widely, with bacterial species from groups such as Fusobacteria and Tenericutes having around 30 genes per genome while complex eukaryotic genomes such as

2627-464: The field, has approved unique names for human genes that encode tRNAs. Typically, tRNAs genes from Bacteria are shorter (mean = 77.6 bp) than tRNAs from Archaea (mean = 83.1 bp) and eukaryotes (mean = 84.7 bp). The mature tRNA follows an opposite pattern with tRNAs from Bacteria being usually longer (median = 77.6 nt) than tRNAs from Archaea (median = 76.8 nt), with eukaryotes exhibiting the shortest mature tRNAs (median = 74.5 nt). Genomic tRNA content

2698-592: The first anticodon position—sometimes known as the "wobble position"—resulting in subtle changes to the genetic code, as for example in mitochondria . The possibility of wobble bases reduces the number of tRNA types required: instead of 61 types with one for each sense codon of the standard genetic code), only 31 tRNAs are required to translate, unambiguously, all 61 sense codons. A tRNA is commonly named by its intended amino acid (e.g. tRNA-Asn ), by its anticodon sequence (e.g. tRNA(GUU) ), or by both (e.g. tRNA-Asn(GUU) or tRNA GUU ). These two features describe

2769-468: The first nucleotide of the anticodon is one not found on mRNA: inosine , which can hydrogen bond to more than one base in the corresponding codon position. In genetic code , it is common for a single amino acid to be specified by all four third-position possibilities, or at least by both pyrimidines and purines ; for example, the amino acid glycine is coded for by the codon sequences GGU, GGC, GGA, and GGG. Other modified nucleotides may also appear at

2840-528: The formation of stress granules, displace mRNAs from RNA-binding proteins or inhibit translation. At the system or the organismal level, the four types of tRFs have a diverse spectrum of activities. Functionally, tRFs are associated with viral infection, cancer, cell proliferation and also with epigenetic transgenerational regulation of metabolism. tRFs are not restricted to humans and have been shown to exist in multiple organisms. Two online tools are available for those wishing to learn more about tRFs:

2911-461: The framework for the interactive exploration of mi tochondrial and n uclear t RNA fragments ( MINTbase ) and the relational database of T ransfer R NA related F ragments ( tRFdb ). MINTbase also provides a naming scheme for the naming of tRFs called tRF-license plates (or MINTcodes) that is genome independent; the scheme compresses an RNA sequence into a shorter string. tRNAs with modified anticodons and/or acceptor stems can be used to modify

Translocase - Misplaced Pages Continue

2982-497: The genetic code. Scientists have successfully repurposed codons (sense and stop) to accept amino acids (natural and novel), for both initiation (see: start codon ) and elongation. In 1990, tRNA CUA (modified from the tRNA CAU gene metY ) was inserted into E. coli , causing it to initiate protein synthesis at the UAG stop codon, as long as it is preceded by a strong Shine-Dalgarno sequence . At initiation it not only inserts

3053-407: The growing polypeptide to the aminoacyl-tRNA bound in the A/A site, is bound in the P/P site. Once the peptide bond is formed, the tRNA in the P/P site is acylated, or has a free 3' end , and the tRNA in the A/A site dissociates the growing polypeptide chain. To allow for the next elongation cycle, the tRNAs then move through hybrid A/P and P/E binding sites, before completing the cycle and residing in

3124-466: The hydrolysis of a nucleoside triphosphate. Subclasses are based on the reaction processes that provide the driving force for the translocation. At present there is only one subclass: EC 7.4.2 Translocation of amino acids and peptides linked to the hydrolysis of a nucleoside triphosphate. Elongation factor G EF-G ( elongation factor G , historically known as translocase ) is a prokaryotic elongation factor involved in mRNA translation . As

3195-486: The important group of enzymes that catalyse the movement of ions or molecules across membranes or their separation within membranes. Several of these involve the hydrolysis of ATP and had been previously classified as ATPases (EC 3.6.3.-), although the hydrolytic reaction is not their primary function. In August 2018, the International Union of Biochemistry and Molecular Biology classified these enzymes under

3266-425: The mRNA decoding site is located. The mRNA decoding site is where the mRNA codon is read out during translation. The T-site half resides mainly on the large ribosomal subunit where EF-Tu or eEF-1 interacts with the ribosome. Once mRNA decoding is complete, the aminoacyl-tRNA is bound in the A/A site and is ready for the next peptide bond to be formed to its attached amino acid. The peptidyl-tRNA, which transfers

3337-432: The mRNA. If the tRNA's anticodon matches the mRNA, another tRNA already bound to the ribosome transfers the growing polypeptide chain from its 3' end to the amino acid attached to the 3' end of the newly delivered tRNA, a reaction catalysed by the ribosome. A large number of the individual nucleotides in a tRNA molecule may be chemically modified , often by methylation or deamidation . These unusual bases sometimes affect

3408-442: The main function of the tRNA, but do not actually cover the whole diversity of tRNA variation; as a result, numerical suffixes are added to differentiate. tRNAs intended for the same amino acid are called "isotypes"; these with the same anticodon sequence are called "isoacceptors"; and these with both being the same but differing in other places are called "isodecoders". Aminoacylation is the process of adding an aminoacyl group to

3479-470: The opossum suggesting the possibility that the lookalikes are functional. Cytoplasmic tRNA genes can be grouped into 49 families according to their anticodon features. These genes are found on all chromosomes, except the 22 and Y chromosome. High clustering on 6p is observed (140 tRNA genes), as well as on chromosome 1. The HGNC , in collaboration with the Genomic tRNA Database ( GtRNAdb ) and experts in

3550-415: The propensity for translation errors. The reasons why tRNA genes have been lost during evolution remains under debate but may relate improving resistance to viral infection. Because nucleotide triplets can present more combinations than there are amino acids and associated tRNAs, there is redundancy in the genetic code, and several different 3-nucleotide codons can express the same amino acid. This codon bias

3621-445: The reaction they're linked to, EC 7.2 can be further classified into: An important translocase contained in this group is Na+/K+ pump , also known as EC 7.2.2.13. This subclass contains translocases that transfer inorganic cations anions. Subclasses are based on the reaction processes that provide the driving force for the translocation. At present only one subclass is represented: EC 7.3.2 Translocation of inorganic anions linked to

SECTION 50

#1732801250392

3692-408: The relatively long tRNA halves and short 5'-tRFs, 3'-tRFs and i-tRFs. The precursor tRNA can be cleaved to produce molecules from the 5' leader or 3' trail sequences. Cleavage enzymes include Angiogenin, Dicer, RNase Z and RNase P. Especially in the case of Angiogenin, the tRFs have a characteristically unusual cyclic phosphate at their 3' end and a hydroxyl group at the 5' end. tRFs appear to play

3763-411: The rest of isoacceptors, and this has been correlated with its A-to-I modification of its wobble base. This same trend has been shown for most amino acids of eukaryal species. Indeed, the effect of these two tRNA modifications is also seen in codon usage bias . Highly expressed genes seem to be enriched in codons that are exclusively using codons that will be decoded by these modified tRNAs, which suggests

3834-470: The ribosomal subunit rotation. This motion actively splits the B2a/B2b bridge, which connects the 30S and the 50S subunits, so that the ribosome can split. IF3 then isolates the 30S subunit to prevent re-association of the large and small subunits. EF-G in pathogenic bacteria can be inhibited by antibiotics that prevent EF-G from binding to the ribosome, carrying out translocation or dissociating from

3905-635: The ribosome, and contains the N-terminal of the polypeptide chain. Domain IV is important for translocation, as it undergoes a significant conformational change and enters the A site on the 30S ribosomal subunit , pushing the mRNA and tRNA molecules from the A site to the P site. The five domains may be also separated into two super-domains. Super-domain I consists of Domains I and II, and super-domain II consists of Domains III - IV. Throughout translocation, super-domain I will remain relatively unchanged, as it

3976-477: The ribosome, preventing EF-G from dissociating. However, some bacterial strains have developed resistance to fusidic acid due to point mutations in the fusA gene, which prevents fusidic acid from binding to EF-G. EF-G has a complex evolutionary history, with numerous paralogous versions of the factor present in bacteria, suggesting subfunctionalization of different EF-G variants. Elongation factors exist in all three domains of life with similar function on

4047-474: The ribosome. For example, the antibiotic thiostrepton prevents EF-G from binding stably to the ribosome, while the antibiotics dityromycin and GE82832 inhibit the activity of EF-G by preventing the translocation of the A site tRNA. Dityromycin and GE82832 do not affect the binding of EF-G to the ribosome, however. The antibiotic fusidic acid is known to inhibit Staphylococcus aureus and other bacteria by binding to EF-G after one translocation event on

4118-506: The ribosome. The eukaryotic and archeal homologs of EF-G are eEF2 and aEF2, respectively. In bacteria (and some archaea), the fusA gene that encodes EF-G is found within the conserved str gene with the sequence 5′ - rpsL - rpsG - fusA - tufA - 3′. However, two other major forms of EF-G exist in some species of S pirochaetota , P lanctomycetota , and δ- P roteobacteria (which has since been split and renamed Bdellovibrionota , Myxococcota , and Thermodesulfobacteriota ), which form

4189-400: The same amino acid. The covalent attachment to the tRNA 3' end is catalysed by enzymes called aminoacyl tRNA synthetases . During protein synthesis, tRNAs with attached amino acids are delivered to the ribosome by proteins called elongation factors , which aid in association of the tRNA with the ribosome, synthesis of the new polypeptide, and translocation (movement) of the ribosome along

4260-516: The second promoter is located 30–60 nucleotides downstream of the first promoter. The transcription terminates after a stretch of four or more thymidines . Pre-tRNAs undergo extensive modifications inside the nucleus. Some pre-tRNAs contain introns that are spliced, or cut, to form the functional tRNA molecule; in bacteria these self- splice , whereas in eukaryotes and archaea they are removed by tRNA-splicing endonucleases . Eukaryotic pre-tRNA contains bulge-helix-bulge (BHB) structure motif that

4331-473: The splicing is not carried out in the nucleus but at the cytoplasmic side of mitochondrial membranes. The existence of tRNA was first hypothesized by Francis Crick as the " adaptor hypothesis " based on the assumption that there must exist an adapter molecule capable of mediating the translation of the RNA alphabet into the protein alphabet. Paul C Zamecnik , Mahlon Hoagland , and Mary Louise Stephenson discovered tRNA. Significant research on structure

SECTION 60

#1732801250392

4402-466: The sub-subclasses indicate the reaction processes that provide the driving force for the translocation. This subclass contains translocases that catalyze the translocation of hydrons . Based on the reaction they are linked to, EC 7.1 can be further classified into: An important translocase contained in this group is ATP synthase , also known as EC 7.1.2.2. This subclass contains translocases that transfer inorganic cations (metal cations). Based on

4473-449: The subsequent recycling is catalyzed by a Class II release factor named RF3/prfC, Ribosome recycling factor (RRF), Initiation Factor 3 (IF3) and EF-G. The protein RF3 releases the Class I release factor so that it may occupy the ribosomal A site. EF-G hydrolyzes GTP and undergoes a large conformational change to push RF3 down the ribosome, which occurs alongside tRNA dissociation and promotes

4544-548: The synthetases is not mediated solely by the anticodon, and the acceptor stem often plays a prominent role. Reaction: Certain organisms can have one or more aminophosphate-tRNA synthetases missing. This leads to charging of the tRNA by a chemically related amino acid, and by use of an enzyme or enzymes, the tRNA is modified to be correctly charged. For example, Helicobacter pylori has glutaminyl tRNA synthetase missing. Thus, glutamate tRNA synthetase charges tRNA-glutamine(tRNA-Gln) with glutamate . An amidotransferase then converts

4615-543: The tRNA gene copy number across different species has been linked to the appearance of specific tRNA modification enzymes (uridine methyltransferases in Bacteria, and adenosine deaminases in Eukarya), which increase the decoding capacity of a given tRNA. As an example, tRNA encodes four different tRNA isoacceptors (AGC, UGC, GGC and CGC). In Eukarya, AGC isoacceptors are extremely enriched in gene copy number in comparison to

4686-445: The tRNA's interaction with ribosomes and sometimes occur in the anticodon to alter base-pairing properties. The structure of tRNA can be decomposed into its primary structure , its secondary structure (usually visualized as the cloverleaf structure ), and its tertiary structure (all tRNAs have a similar L-shaped 3D structure that allows them to fit into the P and A sites of the ribosome ). The cloverleaf structure becomes

4757-521: The traditional formylmethionine , but also formylglutamine, as glutamyl-tRNA synthase also recognizes the new tRNA. The experiment was repeated in 1993, now with an elongator tRNA modified to be recognized by the methionyl-tRNA formyltransferase . A similar result was obtained in Mycobacterium . Later experiments showed that the new tRNA was orthogonal to the regular AUG start codon showing no detectable off-target translation initiation events in

4828-474: The variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor),

4899-589: The zebrafish ( Danio rerio ) can bear more than 10 thousand tRNA genes. In the human genome, which, according to January 2013 estimates, has about 20,848 protein coding genes in total, there are 497 nuclear genes encoding cytoplasmic tRNA molecules, and 324 tRNA-derived pseudogenes —tRNA genes thought to be no longer functional (although pseudo tRNAs have been shown to be involved in antibiotic resistance in bacteria). As with all eukaryotes, there are 22 mitochondrial tRNA genes in humans. Mutations in some of these genes have been associated with severe diseases like

4970-566: Was ascertained by several other studies in the following years and was finally confirmed using X-ray crystallography studies in 1974. Two independent groups, Kim Sung-Hou working under Alexander Rich and a British group headed by Aaron Klug , published the same crystallography findings within a year. Interference with aminoacylation may be useful as an approach to treating some diseases: cancerous cells may be relatively vulnerable to disturbed aminoacylation compared to healthy cells. The protein synthesis associated with cancer and viral biology

5041-669: Was conducted in the early 1960s by Alex Rich and Donald Caspar , two researchers in Boston, the Jacques Fresco group in Princeton University and a United Kingdom group at King's College London . In 1965, Robert W. Holley of Cornell University reported the primary structure and suggested three secondary structures. tRNA was first crystallized in Madison, Wisconsin, by Robert M. Bock. The cloverleaf structure

#391608