Misplaced Pages

#300699

127-744: G-M201 is most commonly found among various ethnic groups of the Caucasus , but is also widely distributed at low frequencies among ethnic groups throughout Europe , West Asia , South Asia , Central Asia , and North Africa . The most commonly occurring subclades are G1* (M285) and many subclades of G2 (G-P287), especially: G2a (P15), G2a1 (G-FGC7535, formerly G-L293), G2a2b2a (G-P303) formerly G2a3b1); G2a2b1 (G-M406) formerly G2a3a; G2a2b2a1 (G-L140) formerly G2a3b1a; G2a2b2a1a1b (G-L497) formerly G2a3b1a2; G2a2b2a1a1a1 (G-L13) formerly G2a3b1a1a; G2a2b2a1a1c1a (G-CTS5990 or G-Z1903) formerly G2a3b1a3; G2b (G-M3115) and; G2b1 (G-M377), formerly G2b. Previously

254-699: A GAA triplet expansion in the first intron of the X25 gene appears to interfere with transcription, and causes Friedreich's ataxia . Tandem repeats in the first intron of the Asparagine synthetase gene are linked to acute lymphoblastic leukaemia. A repeat polymorphism in the fourth intron of the NOS3 gene is linked to hypertension in a Tunisian population. Reduced repeat lengths in the EGFR gene are linked with osteosarcomas. An archaic form of splicing preserved in zebrafish

381-460: A SNP-defined linkage disequilibrium block of interest. Thus, microsatellites have successfully led to discoveries of type 2 diabetes ( TCF7L2 ) and prostate cancer genes (the 8q21 region). Microsatellites were popularized in population genetics during the 1990s because as PCR became ubiquitous in laboratories researchers were able to design primers and amplify sets of microsatellites at low cost. Their uses are wide-ranging. A microsatellite with

508-479: A blacksmith god, and Batradz , a mighty hero. The folklore of the Caucasus shows ancient Iranian Zoroastrian influence, involve battles with ancient Goths , Huns and Khazars , and contain many connections with ancient Indian , Norse Scandinavian , and Greek cultures. Caucasian folklore contains many links with the myths of the ancient Greeks. There are resemblances between the mother goddess Satanaya and

635-455: A conserved or nonconserved region, this technique is not useful for distinguishing individuals, but rather for phylogeography analyses or maybe delimiting species ; sequence diversity is lower than in SSR-PCR, but still higher than in actual gene sequences. In addition, microsatellite sequencing and ISSR sequencing are mutually assisting, as one produces primers for the other. Repetitive DNA

762-470: A gene or a mutation responsible for a given trait or disease. Microsatellites are also used in population genetics to measure levels of relatedness between subspecies, groups and individuals. Although the first microsatellite was characterised in 1984 at the University of Leicester by Weller, Jeffreys and colleagues as a polymorphic GGAT repeat in the human myoglobin gene, the term "microsatellite"

889-515: A genome region between microsatellite loci. The complementary sequences to two neighboring microsatellites are used as PCR primers; the variable region between them gets amplified. The limited length of amplification cycles during PCR prevents excessive replication of overly long contiguous DNA sequences, so the result will be a mix of a variety of amplified DNA strands which are generally short but vary much in length. Sequences amplified by ISSR-PCR can be used for DNA fingerprinting. Since an ISSR may be

1016-761: A high degree of error-free data while being short enough to survive degradation in non-ideal conditions. Even shorter repeat sequences would tend to suffer from artifacts such as PCR stutter and preferential amplification, while longer repeat sequences would suffer more highly from environmental degradation and would amplify less well by PCR . Another forensic consideration is that the person's medical privacy must be respected, so that forensic STRs are chosen which are non-coding, do not influence gene regulation, and are not usually trinucleotide STRs which could be involved in triplet expansion diseases such as Huntington's disease . Forensic STR profiles are stored in DNA databanks such as

1143-497: A microsatellite repeat, if present on the DNA segment. If positive clones can be obtained from this procedure, the DNA is sequenced and PCR primers are chosen from sequences flanking such regions to determine a specific locus . This process involves significant trial and error on the part of researchers, as microsatellite repeat sequences must be predicted and primers that are randomly isolated may not display significant polymorphism. Microsatellite loci are widely distributed throughout

1270-403: A neutral evolutionary history makes it applicable for measuring or inferring bottlenecks , local adaptation , the allelic fixation index (F ST ), population size , and gene flow . As next generation sequencing becomes more affordable the use of microsatellites has decreased, however they remain a crucial tool in the field. Marker assisted selection or marker aided selection (MAS)

1397-480: A point mutation has created an extended GGAA microsatellite which binds a transcription factor, which in turn activates the EGR2 gene which drives the cancer. In addition, other GGAA microsatellites may influence the expression of genes that contribute to the clinical outcome of Ewing sarcoma patients. Microsatellites within introns also influence phenotype, through means that are not currently understood. For example,

SECTION 10

#1732790184301

1524-399: A single nucleotide, microsatellite mutations lead to the gain or loss of an entire repeat unit, and sometimes two or more repeats simultaneously. Thus, the mutation rate at microsatellite loci is expected to differ from other mutation rates, such as base substitution rates. The mutation rate at microsatellite loci depends on the repeat motif sequence, the number of repeated motif units and

1651-612: A sizeable group in so far poorly tested areas east of Turkey. P15 was identified at the University of Arizona and became widely known by 2002. Its chromosome location listed as 21653414. G2a was found in medieval remains in a 7th- century CE high-status tomb in Ergolding, Bavaria , Germany, but G2a subclades were not tested. There are multiple SNPs which so far have the same coverage as P15. They are—with accompanying Y-chromosome locations—U5 (rs2178500), L149 (8486380) and L31 (also called S149) (rs35617575..12538148). Should any man with

1778-444: A small amount of testing has occurred for the relevant mutations. So far the men positive for this have had Irish, English, Dutch, Lebanese and/or Turkish (Armenian surname) ancestry. Several G-PF3359 subclades, based on shared STR markers, probably exist. Caucasus The Caucasus ( / ˈ k ɔː k ə s ə s / ) or Caucasia ( / k ɔː ˈ k eɪ ʒ ə / ), is a region spanning Eastern Europe and Western Asia . It

1905-678: A small number today. This haplogroup was found in a Neolithic skeleton from around 5000 BC, in the cemetery of Derenburg Meerenstieg II, Germany, which forms part of the Linear Pottery culture , known in German as Linearbandkeramik (LBK), but was not tested for G2a3 subclades. G-M406* (G2a2b1*; previously G2a3a*) and its subclades seem most commonly found in Turkey and the coastal areas of the eastern Mediterranean where it can constitute up to 5% of all makes and 50% of haplogroup G samples. G2a2b1

2032-489: A source of genetic predisposition in a variety of cancers. Microsatellite analysis became popular in the field of forensics in the 1990s. It is used for the genetic fingerprinting of individuals where it permits forensic identification (typically matching a crime stain to a victim or perpetrator). It is also used to follow up bone marrow transplant patients. The microsatellites in use today for forensic analysis are all tetra- or penta-nucleotide repeats, as these give

2159-510: A spit, heat it up, stab it into the giant's eye, and escape. There are also links with the ancient Greek myth of Prometheus . Many legends, widespread in the Caucasus, contain motifs shared with the Prometheus story. These motifs include a giant hero, his conflict with God or gods, the stealing of fire and giving it to men, being chained, and being tormented by a bird who pecks at his liver (or heart). The Adyge / Circassian Nart Nasran,

2286-401: A tumour cell line might show a different genetic fingerprint from that of the host tissue, and, especially in colorectal cancer , might present with loss of heterozygosity . Microsatellites analyzed in primary tissue therefore been routinely used in cancer diagnosis to assess tumour progression. Genome Wide Association Studies (GWAS) have been used to identify microsatellite biomarkers as

2413-571: A value of 10, but sometimes 11, in G2a2b1 persons, and DYS392 is almost always 11. If a sample meets the criteria indicated for these three markers, it is likely the sample is G2a2b1. G-CTS2488 or G2a2b2 (also known as G-L141.1; previously G-141 and G2a3b) was identified only in mid-2009 at Family Tree DNA . Almost all L141 men belong to L141 subclades. Samples from persons with British Isles, Sicilian and Turkish ancestry have been identified. L141 persons who do not belong to any L141 subclade so far have

2540-550: Is a large size difference between individual alleles, then there may be increased instability during recombination at meiosis. Another possible cause of microsatellite mutations are point mutations, where only one nucleotide is incorrectly copied during replication. A study comparing human and primate genomes found that most changes in repeat number in short microsatellites appear due to point mutations rather than slippage. Direct estimates of microsatellite mutation rates have been made in numerous organisms, from insects to humans. In

2667-816: Is a rare group today in Europe. The authors of the Spanish study indicated that the Avellaner men had rare marker values in testing of their short tandem repeat (STR) markers. During the Chalcolithic , haplogroup G was considered ubiquitous in Anatolia, constituting a significant amount of local Y-DNA haplogroups, along with haplogroup J. It remained common throughout the Chalcolithic, Bronze and pre-Roman ages. A 2004 paper found significant correlation between

SECTION 20

#1732790184301

2794-614: Is a tract of repetitive DNA in which certain DNA motifs (ranging in length from one to six or more base pairs ) are repeated, typically 5–50 times. Microsatellites occur at thousands of locations within an organism's genome . They have a higher mutation rate than other areas of DNA leading to high genetic diversity . Microsatellites are often referred to as short tandem repeats ( STRs ) by forensic geneticists and in genetic genealogy , or as simple sequence repeats ( SSRs ) by plant geneticists. Microsatellites and their longer cousins,

2921-574: Is an indirect selection process where a trait of interest is selected based on a marker ( morphological , biochemical or DNA / RNA variation) linked to a trait of interest (e.g. productivity, disease resistance, stress tolerance, and quality), rather than on the trait itself. Microsatellites have been proposed to be used as such markers to assist plant breeding. Repetitive DNA is not easily analysed by next generation DNA sequencing methods, for some technologies struggle with homopolymeric tracts. A variety of software approaches have been created for

3048-556: Is considered by some sources to be the dividing line between Europe and Southwest Asia . According to that, the highest peak in the Caucasus, Mount Elbrus (5,642 meters) located in western Ciscaucasus, is considered the highest point in Europe. The Kuma-Manych Depression , the geologic depression that divides the Russian Plain from the North Caucasus foreland is often regarded by classical and non-British sources as

3175-530: Is found as far east as northern China in small percentages where G can reach more substantial percentages in minority groups such as the Uyghurs. In Turkey, the South Caucasus and Iran , haplogroup G reaches the highest percentage of national populations. Among Turkish males 11% of the population is G. In Iran, Haplogroup G reaches 13 to 15% of the population in various parts of the country. While it

3302-667: Is found at 21327383 and rs35474563 on the Y-chromosome. The forward primer is GTATTGAACTTACAATTCACGTCCC , and the reverse is CTCTCCAAATCGGGTTTCCT . The mutation involves a change from C to T. L223 is found on the Y chromosome at rs13304806. The G-M286 subclade (M286+) is small compared with G-L91. Samples have been identified in England, Germany, Montenegro (Bosniak), Spain, Cyprus (Greek), Turkey, Armenia, Georgia, Lebanon, Syria and Kuwait. The British samples have inconsistent double values for STR marker DYS19 in many cases. M286

3429-590: Is found in percentages higher than 10% among the Bakhtiari , Talysh people , Gilaki , Mazandarani and Iranian Azeris , it is closer to 5% among the Iranian Arabs and in some large cities. Among the samples in the YHRD database from the southern Caucasus countries, 29% of the samples from Abazinia , 31% from Georgia , 18% from Azerbaijan and 11% from Armenia appear to be G samples. In Europe west of

3556-415: Is known to use microsatellite sequences within intronic mRNA for the removal of introns in the absence of U2AF2 and other splicing machinery. It is theorized that these sequences form highly stable cloverleaf configurations that bring the 3' and 5' intron splice sites into close proximity, effectively replacing the spliceosome . This method of RNA splicing is believed to have diverged from human evolution at

3683-596: Is more common in southern Europe than northern Europe. In Europe—except in Italy – G2a2b1 constitutes less than 20% of G samples. G2a2b1 so far has seldom surfaced in northern Africa or southern Asia, but represents a small percentage of the G population in the Caucasus Mountains region and in Iran . A relatively high percentage of G2a2b1 persons have a value of 21 at STR marker DYS390. The DYS391 marker has mostly

3810-580: Is quite distinct and differs from that of the other Western Eurasian refugia. The natural landscape is one of mixed forest , with substantial areas of rocky ground above the treeline. The Caucasus Mountains are also noted for a dog breed , the Caucasian Shepherd Dog (Rus. Kavkazskaya Ovcharka, Geo. Nagazi). Vincent Evans noted that minke whales have been recorded from the Black Sea. Short tandem repeat A microsatellite

3937-474: Is rare. Some ethnic minorities possess it at considerable concentrations, including approximately 18% to 20% of Kalash , approximately 16% of Brahui , and approximately 11.5% of sampled Pashtun , all of whom native to the easternmost regions of the Iranian Plateau , while it only appears in about 3% of the general Pakistani population. In a study of 936 Indians , haplogroup G made up less than 1% of

Haplogroup G-M201 - Misplaced Pages Continue

4064-417: Is repeatedly denatured at a high temperature to separate the double strand, then cooled to allow annealing of primers and the extension of nucleotide sequences through the microsatellite. This process results in production of enough DNA to be visible on agarose or polyacrylamide gels; only small amounts of DNA are needed for amplification because in this way thermocycling creates an exponential increase in

4191-743: Is situated between the Black Sea and the Caspian Sea , mainly comprising Armenia , Azerbaijan , Georgia , and parts of Southern Russia . The Caucasus Mountains , including the Greater Caucasus range, have conventionally been considered as a natural barrier between Europe and Asia , bisecting the Eurasian landmass. Mount Elbrus , Europe 's highest mountain, is situated in the Western Caucasus area of Russia . On

4318-499: Is speculative given that Pelasgian is so poorly known. The term Caucasus is not only used for the mountains themselves but also includes Ciscaucasia (which is part of the Russian Federation ) and Transcaucasia . According to Alexander Mikaberidze , Transcaucasia is a "Russo-centric" term. The Transcaucasus region and Dagestan were the furthest points of Parthian and later Sasanian expansions, with areas to

4445-443: Is the cause of microsatellite mutations. Typically, slippage in each microsatellite occurs about once per 1,000 generations. Thus, slippage changes in repetitive DNA are three orders of magnitude more common than point mutations in other parts of the genome. Most slippage results in a change of just one repeat unit, and slippage rates vary for different allele lengths and repeat unit sizes, and within different species. If there

4572-502: Is variously a one-eyed rock-throwing cannibal, who lives in a cave (the exit of which is often blocked by a stone), kills the hero's companions, is blinded by a hot stake, and whose flock of animals is stolen by the hero and his men, all motifs which (along with still others) are also found in the Polyphemus story. In one example from Georgia , two brothers, who are being held prisoner by a giant one-eyed shepherd called "One-eye", take

4699-509: The Tale of Past Years (1113 AD), it is stated that Old East Slavic Кавкасийскыѣ горы ( Kavkasijskyě gory ) came from Ancient Greek Καύκασος ( Kaúkasos ), which, according to M. A. Yuyukin, is a compound word that can be interpreted as the 'mountain of the seagull(s)' (καύ-: καύαξ, καύηξ, -ηκος, κήξ, κηϋξ 'a kind of seagull' + the reconstructed *κάσος 'mountain' or 'rock' richly attested both in place and personal names). In Georgian tradition,

4826-694: The Achaemenid Empire , Parthia , and the Sassanid Empire , who would altogether rule the Caucasus for many hundreds of years. In 95–55 BC, under the reign of the Armenian king Tigranes the Great , the Kingdom of Armenia included Kingdom of Armenia, vassals Iberia, Albania, Parthia, Atropatene , Mesopotamia , Cappadocia , Cilicia , Syria , Nabataean kingdom , and Judea . By the time of

4953-926: The Avellaner cave burial site, near Les Planes d'Hostoles , in Catalonia , Spain and were dated by radiocarbon dating to about 5000 BCE. A skeleton found at the Neolithic cemetery known as Derenburg Meerenstieg II , in Saxony-Anhalt Germany , apparently belonged to G2a3 (G-S126) or a subclade. It was found with burial artifacts belonging to the Linearbandkeramische Kultur (" Linear Band Ceramic Culture "; LBK). This skeleton could not be dated by radiocarbon dating, but other skeletons there were dated to between 5,100 and 6,100 years old. The most detailed SNP mutation identified

5080-619: The Black Sea , Haplogroup G is found at about 5% of the population on average throughout most of the continent. The concentration of G falls below this average in Scandinavia , the westernmost former Soviet republics and Poland , as well as in Iceland and the British Isles . There are seeming pockets of unusual concentrations within Europe. In Wales , a distinctive G2a3b1 type (DYS388=13 and DYS594=11) dominates there and pushes

5207-741: The Georgian Amirani , the Chechen Pkharmat , and the Abkhazian Abrskil , are examples of such Prometheus-like figures. The Caucasus is an area of great ecological importance. The region is included in the list of 34 world biodiversity hotspots . It harbors some 6400 species of higher plants, 1600 of which are endemic to the region. Its wildlife includes Persian leopards , brown bears , wolves , bison , marals , golden eagles and hooded crows . Among invertebrates , some 1000 spider species are recorded in

Haplogroup G-M201 - Misplaced Pages Continue

5334-773: The Greater Caucasus mountain range. It consists of Southern Russia , mainly the North Caucasian Federal District 's autonomous republics and the Krais in Southern Russia, and the northernmost parts of Georgia and Azerbaijan . The North Caucasus lies between the Black Sea to its west, the Caspian Sea to its east, and borders the Southern Federal District to its north. The two Federal Districts are collectively referred to as "Southern Russia". The South Caucasus borders

5461-605: The HOXA13 gene are linked to hand-foot-genital syndrome , a developmental disorder in humans. Length changes in other triplet repeats are linked to more than 40 neurological diseases in humans, notably trinucleotide repeat disorders such as fragile X syndrome and Huntington's disease . Evolutionary changes from replication slippage also occur in simpler organisms. For example, microsatellite length changes are common within surface membrane proteins in yeast, providing rapid evolution in cell properties. Specifically, length changes in

5588-596: The Hattian and Kaskian cultures, with the presence of haplogroup G, noting however that higher variances of the G2-P15 subclade exist towards western Anatolia. In Russia, Ukraine and Central Asia , members of various ethnic minorities and/or residents in particular localities possess G-M201 at its highest levels in the world – even though the average rate at the national level is about 1% or less. The Madjar and Argyn tribes (or clans) of Kazakhstan were found to possess

5715-516: The Middle East , haplogroup G accounts for about 3% of the population in almost all areas. Among the Druze mostly residents of Israel 10% were found to be haplogroup G. Around 10% of Jewish males are Haplogroup G. In Africa , haplogroup G is rarely found in sub-Saharan Africa or south of the horn of Africa among native populations. In Egypt , studies have provided information that pegs

5842-745: The Muslim conquest of Persia , large parts of the region came under the rule of the Arabs , and Islam penetrated the region. In the 10th century, the Alans (proto- Ossetians ) founded the Kingdom of Alania , that flourished in the Northern Caucasus , roughly in the location of latter-day Circassia and modern North Ossetia–Alania , until its destruction by the Mongol invasion in 1238–39. During

5969-669: The National Geographic Society placed its origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic . Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. Semino et al. (2000) suggested 17,000 years ago. Cinnioglu et al. (2004) suggested the mutation took place only 9,500 years ago. Various estimated dates and locations have been proposed for

6096-755: The Ottoman Empire . In the second half of the 19th century, the Russian Empire also conquered the North Caucasus. In the aftermath of the Caucasian Wars , the Russian military perpetrated an ethnic cleansing of Circassians , expelling this indigenous population from its homeland. Between the 1850s and World War I, about a million North Caucasian Muslims arrived in the Ottoman Empire as refugees. Having killed and deported most of

6223-606: The Simurgh . The Roman poet Ovid placed the Caucasus in Scythia and depicted it as a cold and stony mountain which was the abode of personified hunger. The Greek hero Jason sailed to the west coast of the Caucasus in pursuit of the Golden Fleece , and there met Medea , a daughter of King Aeëtes of Colchis . The Caucasus has a rich folklore tradition. This tradition has been preserved orally—necessitated by

6350-623: The UK National DNA Database (NDNAD), the American CODIS or the Australian NCIDD. Autosomal microsatellites are widely used for DNA profiling in kinship analysis (most commonly in paternity testing). Paternally inherited Y-STRs (microsatellites on the Y chromosome ) are often used in genealogical DNA testing . During the 1990s and the first several years of this millennium, microsatellites were

6477-547: The desert locust Schistocerca gregaria , the microsatellite mutation rate was estimated at 2.1 × 10 per generation per locus. The microsatellite mutation rate in human male germ lines is five to six times higher than in female germ lines and ranges from 0 to 7 × 10 per locus per gamete per generation. In the nematode Pristionchus pacificus , the estimated microsatellite mutation rate ranges from 8.9 × 10 to 7.5 × 10 per locus per generation. Microsatellite mutation rates vary with base position relative to

SECTION 50

#1732790184301

6604-516: The minisatellites , together are classified as VNTR (variable number of tandem repeats ) DNA. The name "satellite" DNA refers to the early observation that centrifugation of genomic DNA in a test tube separates a prominent layer of bulk DNA from accompanying "satellite" layers of repetitive DNA. They are widely used for DNA profiling in cancer diagnosis , in kinship analysis (especially paternity testing ) and in forensic identification. They are also used in genetic linkage analysis to locate

6731-690: The "inhabitants of the southern coast of the Black Sea ". It was also noted that in Nakh Ков гас ( Kov gas ) means "gateway to steppe". The modern endonym for the region is usually similar in many languages, and is generally between Kavkaz and Kaukaz . The North Caucasus region is also known as the Ciscaucasus , whereas the South Caucasus region is alternatively known as the Transcaucasus . The North Caucasus contains most of

6858-797: The Armenians of Western Armenia during the Armenian genocide , the Turks intended to eliminate the Armenian population of Eastern Armenia . During the 1920 Turkish–Armenian War , 60,000 to 98,000 Armenian civilians were estimated to have been killed by the Turkish army. In the 1940s, around 480,000 Chechens and Ingush , 120,000 Karachay – Balkars and Meskhetian Turks , thousands of Kalmyks , and 200,000 Kurds in Nakchivan and Caucasus Germans were deported en masse to Central Asia and Siberia by

6985-456: The Caucasus region. As a result of her military campaigns and the temporary fall of the Byzantine Empire in 1204, Georgia became the strongest Christian state in the whole Near East area, encompassing most of the Caucasus stretching from Northern Iran and Northeastern Turkey to the North Caucasus. The Caucasus region was conquered by the Ottomans , Turco-Mongols , local kingdoms and khanates, as well as, once again, Iran . Up to and including

7112-423: The Caucasus was usually incorporated into the Iranian world . At the beginning of the 19th century, the Russian Empire conquered the territory from Qajar Iran . The territory of the Caucasus region was inhabited by Homo erectus since the Paleolithic Era . In 1991, early Hominini fossils dating back 1.8 million years were found at the Dmanisi archaeological site in Georgia . Scientists now classify

7239-474: The Caucasus. Most of arthropod biodiversity is concentrated on Great and Lesser Caucasus ranges. The region has a high level of endemism and several relict animals and plants, the fact reflecting the presence of refugial forests, which survived the Ice Age in the Caucasus Mountains. The Caucasus forest refugium is the largest throughout the Western Asian (near Eastern) region. The area has multiple representatives of disjunct relict groups of plants with

7366-411: The European Alps. G-L91 would seem to encompass a significant proportion of men belonging to G. L91 is found so far in scattered parts of Europe and North Africa and in Armenia . Included within G-L91 are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not L91+. The double 19 value situation is not seen in the G2a1 and G2a3 subclades. The L91 mutation

7493-643: The FLO1 gene control the level of adhesion to substrates. Short sequence repeats also provide rapid evolutionary change to surface proteins in pathenogenic bacteria; this may allow them to keep up with immunological changes in their hosts. Length changes in short sequence repeats in a fungus ( Neurospora crassa ) control the duration of its circadian clock cycles. Length changes of microsatellites within promoters and other cis-regulatory regions can change gene expression quickly, between generations. The human genome contains many (>16,000) short sequence repeats in regulatory regions, which provide 'tuning knobs' on

7620-401: The G percentage of the population higher than in England. In the Tirol (Tyrol) of western Austria , the percentage of G-M201 can reach 40% or more; perhaps the most famous example is the ancient remains of the so-called "Iceman", Ötzi . In the northern and highland areas of the island of Sardinia off western Italy , G percentages reach 11% of the population in one study and reached 21% in

7747-506: The G percentage there to be between 2% and 9%. 3% of North African Berbers were found to be haplogroup G. 2% of Arab Moroccans and 0.8% of Berber Moroccans were likewise found to be G. In the Americas , the percentage of haplogroup G corresponds to the numbers of persons from Old World countries who emigrated. It is not found among Native Americans except where intermarriage with non-native persons has occurred. It has been found in Mexican mestizos. Almost all haplogroup G1 persons have

SECTION 60

#1732790184301

7874-421: The Greater Caucasus range and Southern Russia to its north, the Black Sea and Turkey to its west, the Caspian Sea to its east, and Iran to its south. It contains the Lesser Caucasus mountain range and surrounding lowlands. All of Armenia , Azerbaijan (excluding the northernmost parts), and Georgia (excluding the northernmost parts) are in the South Caucasus. The watershed along the Greater Caucasus range

8001-408: The Greek goddess of love Aphrodite . The story of how the trickster Nart Sosruquo, became invulnerable parallels that of the Greek hero Achilles . The ancient Greek Amazons may be connected to a Caucasian "warrior Forest-Mother, Amaz-an". Caucasian legends include stories involving giants similar to Homer 's Polyphemus story. In these stories, the giant is almost always a shepherd , and he

8128-452: The Middle Ages, Bagratid Armenia , Kingdom of Tashir-Dzoraget , Kingdom of Syunik and Principality of Khachen organized local Armenian population facing multiple threats after the fall of antique Kingdom of Armenia . Caucasian Albania maintained close ties with Armenia and the Church of Caucasian Albania shared the same Christian dogmas with the Armenian Apostolic Church and had a tradition of their Catholicos being ordained through

8255-488: The Middle East where G2a2b2a may have originated. G2a2b2a is also found in India. A majority of members of G-P303 belong to one of its subclades, rather than to G-P303* The largest G-P303* subclade based on available samples is one in which almost all persons have the value of 13 at STR marker DYS388. The SNP L497 encompasses these men, but most G-L497 men belong to its subclade G-Z725, also known as G-DYS388=13. There are additional subclades of DYS388=13 men characterized by

8382-561: The P15 mutation test negative (ancestral) for any of these or vice versa, that finding would be the basis of a new G2a category. Haplogroup G2a1 (also known as G-FGC753 and previously as G-L293) and its subclades represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. They are found only in tiny numbers elsewhere. So far all G2a1 persons have a value of 10 at STR marker DYS392. G2a1a persons also typically have higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons. The North Ossetians in

8509-439: The Patriarch of Armenia. In the 12th century, the Georgian king David the Builder drove the Muslims out of the Caucasus and made the Kingdom of Georgia a strong regional power. In 1194–1204 Georgian Queen Tamar 's armies crushed new Seljuk Turkish invasions from the southeast and south and launched several successful campaigns into Seljuk Turkish-controlled Southern Armenia. The Georgian Kingdom continued military campaigns in

8636-433: The Russian Federation. The Russian divisions include Dagestan , Chechnya , Ingushetia , North Ossetia–Alania , Kabardino–Balkaria , Karachay–Cherkessia , Adygea , Krasnodar Krai , and Stavropol Krai , in clockwise order. Two territories in the region claim independence but are recognized as such by only a handful of entities: Abkhazia , and South Ossetia . Abkhazia and South Ossetia are largely recognized by

8763-417: The SNP have to be examined. Ashkenazi Jewish G2a1a men with northeastern European ancestry form a distinct cluster based on STR marker values. Men from the Caucasus and men from eastern Europe also form distinctive STR clusters. G-PF3147 (previously G-L223 and G-PF3146) is characterized by having the L223 mutation. L223 is found on the Y chromosome at rs810801 and 6405148 with a mutation from C to G. L223

8890-445: The Southern Caucasus (except western Georgia), northwestern Iran, the northeastern Caucasus, eastern Turkey, and as far as Syria. Under Ashurbanipal (669–627 BC), the boundaries of the Assyrian Empire reached as far as the Caucasus Mountains. Later ancient kingdoms of the region included Armenia , Albania , Colchis and Iberia , among others. These kingdoms were later incorporated into various Iranian empires, including Media ,

9017-543: The Soviet security apparatus. About a quarter of them died. The Southern Caucasus region was unified as a single political entity twice – during the Russian Civil War ( Transcaucasian Democratic Federative Republic ) from 9 April 1918 to 26 May 1918, and under the Soviet rule ( Transcaucasian SFSR ) from 12 March 1922 to 5 December 1936. Following the dissolution of the Soviet Union in 1991, Georgia , Azerbaijan and Armenia became independent nations. The region has been subject to various territorial disputes since

9144-521: The Y-DNA SNP definitions used by ISOGG In 2012, several categories found only in one man in research studies were removed from the ISOGG tree causing some renaming.) Ancient G-M201s with sequencing Haplogroup G2a (G-P15) has been identified in Neolithic human remains in Europe dating between 5000 and 3000 BC. These Neolithic Europeans were descendants of Neolithic farmers from Anatolia, among some of

9271-427: The analysis or raw nextgen DNA sequencing reads to determine the genotype and variants at repetitive loci. Microsatellites can be analysed and verified by established PCR amplification and amplicon size determination, sometimes followed by Sanger DNA sequencing . In forensics, the analysis is performed by extracting nuclear DNA from the cells of a sample of interest, then amplifying specific polymorphic regions of

9398-514: The area. Pliny the Elder 's Natural History (77–79 AD) derives the name of the Caucasus from a Scythian name, Croucasis , which supposedly means 'shimmering with snow'. German linguist Paul Kretschmer notes that the Latvian word kruvesis also means 'frozen mud'. Isidore of Seville 's Etymologies ( c.  625 AD) also says the name means shining white like snow: "Thus, toward

9525-446: The area. Russian is used as a lingua franca most notably in the North Caucasus. The peoples of the northern and southern Caucasus mostly are Shia Muslims , Sunni Muslims , Eastern Orthodox Christians or Armenian Christians . Located on the peripheries of Turkey , Iran , and Russia , the region has been an arena for political, military, religious, and cultural rivalries and expansionism for centuries. Throughout its history,

9652-574: The assemblage of fossil skeletons as the subspecies Homo erectus georgicus . The site yields the earliest unequivocal evidence for the presence of early humans outside the African continent; and the Dmanisi skulls are the five oldest hominins ever found outside Africa . Kura–Araxes culture from about 4000 BC until about 2000 BC enveloped a vast area of approximately 1,000 km by 500 km, and mostly encompassed, on modern-day territories,

9779-488: The closest relatives in Eastern Asia, southern Europe, and even North America. Over 70 species of forest snails of the region are endemic. Some relict species of vertebrates are Caucasian parsley frog , Caucasian salamander , Robert's snow vole , and Caucasian grouse , and there are almost entirely endemic groups of animals such as lizards of genus Darevskia . In general, the species composition of this refugium

9906-961: The collapse of the Soviet Union, leading to the First Nagorno-Karabakh War (1988–1994), the East Prigorodny Conflict (1989–1991), the War in Abkhazia (1992–93) , the First Chechen War (1994–1996), the Second Chechen War (1999–2009), Russo-Georgian War (2008), and the Second Nagorno-Karabakh War (2020). In Greek mythology , the Caucasus was one of the pillars supporting the world. After presenting man with

10033-590: The earliest peoples in the world to practice agriculture. G-M201 has also been found in Neolithic Anatolian sites such as Boncuklu dating back to 8300-7600 BCE, and Barcin dating back to 6419-6238 BCE. Furthermore, the majority of all the male skeletons from the European Neolithic period have so far yielded Y-DNA belonging to this haplogroup. The oldest skeletons confirmed by ancient DNA testing as carrying haplogroup G2a were five found in

10160-834: The early 19th century, most of the Southern Caucasus and southern Dagestan all formed part of the Persian Empire . In 1813 and 1828 by the Treaty of Gulistan and the Treaty of Turkmenchay respectively, the Persians were forced to irrevocably cede the Southern Caucasus and Dagestan to Imperial Russia . In the ensuing years after these gains, the Russians took the remaining part of the Southern Caucasus , comprising western Georgia, through several wars from

10287-479: The east, where it rises to a greater height, it is called the Caucasus, due to the whiteness of its snow, for in an eastern language, caucasus means “white,” that is, shining white with a very thick snow cover. For the same reason the Scythians, who live next to this mountain range, call it Croacasim, for among them whiteness or snow is called casim. 3. The Taurus range is likewise called the Caucasus by many." In

10414-438: The enzyme responsible for reading DNA during replication, can slip while moving along the template strand and continue at the wrong nucleotide. DNA polymerase slippage is more likely to occur when a repetitive sequence (such as CGCGCG) is replicated. Because microsatellites consist of such repetitive sequences, DNA polymerase may make errors at a higher rate in these sequence regions. Several studies have found evidence that slippage

10541-602: The expression of many genes. Length changes in bacterial SSRs can affect fimbriae formation in Haemophilus influenzae , by altering promoter spacing. Dinucleotide microsatellites are linked to abundant variation in cis-regulatory control regions in the human genome. Microsatellites in control regions of the Vasopressin 1a receptor gene in voles influence their social behavior, and level of monogamy. In Ewing sarcoma (a type of painful bone cancer in young humans),

10668-873: The extracted DNA by means of the polymerase chain reaction . Once these sequences have been amplified, they are resolved either through gel electrophoresis or capillary electrophoresis , which will allow the analyst to determine how many repeats of the microsatellites sequence in question there are. If the DNA was resolved by gel electrophoresis, the DNA can be visualized either by silver staining (low sensitivity, safe, inexpensive), or an intercalating dye such as ethidium bromide (fairly sensitive, moderate health risks, inexpensive), or as most modern forensics labs use, fluorescent dyes (highly sensitive, safe, expensive). Instruments built to resolve microsatellite fragments by capillary electrophoresis also use fluorescent dyes. Forensic profiles are stored in major databanks. The British data base for microsatellite loci identification

10795-521: The fact that for most of the languages involved, there was no alphabet until the early twentieth century—and only began to be written down in the late nineteenth century. One important tradition is that of the Nart sagas , which tell stories of a race of ancient heroes called the Narts. These sagas include such figures as Satanaya , the mother of the Narts, Sosruquo a shape changer and trickster, Tlepsh

10922-421: The first century BC, Zoroastrianism had become the dominant religion of the region; however, the region would go through two other religious transformations. Owing to the strong rivalry between Persia and Rome , and later Byzantium . The Romans first arrived in the region in the 1st century BC with the annexation of the kingdom of Colchis, which was later turned into the province of Lazicum . The next 600 years

11049-774: The formation of tetrapods and to represent an artifact of an RNA world . Almost 50% of the human genome is contained in various types of transposable elements (also called transposons, or 'jumping genes'), and many of them contain repetitive DNA. It is probable that short sequence repeats in those locations are also involved in the regulation of gene expression. Microsatellites are used for assessing chromosomal DNA deletions in cancer diagnosis. Microsatellites are widely used for DNA profiling , also known as "genetic fingerprinting", of crime stains (in forensics) and of tissues (in transplant patients). They are also widely used in kinship analysis (most commonly in paternity testing). Also, microsatellites are used for mapping locations within

11176-598: The gene underlying a trait or disease. Prominent early applications include the identifications by microsatellite genotyping of the eight-year-old skeletal remains of a British murder victim ( Hagelberg et al. 1991), and of the Auschwitz concentration camp doctor Josef Mengele who escaped to South America following World War II ( Jeffreys et al. 1992). A microsatellite is a tract of tandemly repeated (i.e. adjacent) DNA motifs that range in length from one to six or up to ten nucleotides (the exact definition and delineation to

11303-479: The generations and gives rise to variability that can be used for DNA fingerprinting and identification purposes. Other microsatellites are located in regulatory flanking or intronic regions of genes, or directly in codons of genes – microsatellite mutations in such cases can lead to phenotypic changes and diseases, notably in triplet expansion diseases such as fragile X syndrome and Huntington's disease . Telomeres are linear sequences of DNA that sit at

11430-401: The genome and can be isolated from semi-degraded DNA of older specimens, as all that is needed is a suitable substrate for amplification through PCR. More recent techniques involve using oligonucleotide sequences consisting of repeats complementary to repeats in the microsatellite to "enrich" the DNA extracted ( microsatellite enrichment ). The oligonucleotide probe hybridizes with the repeat in

11557-620: The genome, specifically in genetic linkage analysis to locate a gene or a mutation responsible for a given trait or disease. As a special case of mapping, they can be used for studies of gene duplication or deletion . Researchers use microsatellites in population genetics and in species conservation projects. Plant geneticists have proposed the use of microsatellites for marker assisted selection of desirable traits in plant breeding. In tumour cells, whose controls on replication are damaged, microsatellites may be gained or lost at an especially high frequency during each round of mitosis . Hence

11684-464: The gift of fire, Prometheus (or Amirani in the Georgian version ) was chained there by Zeus , to have his liver eaten daily by an eagle as punishment for defying Zeus's wish to keep the "secret of fire" from humans. In Persian mythology , the Caucasus might be associated with the mythic Mount Qaf which is believed to surround the known world. It is the battlefield of Saoshyant and the nest of

11811-674: The highest levels of G-M201 among any modern ethnic group. Amongst the Madjars, G1 was found at a rate of 87%. A separate study on the Argyns found that 71% of males belong to G1. In the Russian North Caucasus the Kabardinian and Ossetian populations are also notable for high rates of G-M201. Digora , North Ossetia has the highest known concentration of G in a single city, as 74% of the tested men were G. Haplogroup G

11938-826: The island during the time of the Spanish Inquisition , of which a significant portion are identifiable as G-Z725 (DYS388=13). G-PF3359 (or G2a2b2b; previously G2a3b2) was known prior to 2013 as G-L177. The SNP L177 (a.k.a. L1771.1/ L177_1, L1771.2/L177_2, L177.3/L177_3) was withdrawn as an identifier by ISOGG in 2013, after it was "found to be an unreliable palindromic snp". Ancient DNA identified as G-PF3359 has been found at archaeological sites in: Hungary (the subclade G-F872*), dated at 7,500 years before present (BP); Hungary (subclade G-F1193*) 7,150 BP, and; Spain (G-PF3359*) 4,700 BP. The members of G-PF3359 are probably smaller in number than men included in G-P303, but only

12065-447: The longer minisatellites varies from author to author), and are typically repeated 5–50 times. For example, the sequence TATATATATA is a dinucleotide microsatellite, and GTCGTCGTCGTCGTC is a trinucleotide microsatellite (with A being Adenine , G Guanine , C Cytosine , and T Thymine ). Repeat units of four and five nucleotides are referred to as tetra- and pentanucleotide motifs, respectively. Most eukaryotes have microsatellites, with

12192-401: The microsatellite, and the probe/microsatellite complex is then pulled out of solution. The enriched DNA is then cloned as normal, but the proportion of successes will now be much higher, drastically reducing the time required to develop the regions for use. However, which probes to use can be a trial and error process in itself. ISSR (for inter-simple sequence repeat ) is a general term for

12319-924: The microsatellite, repeat type, and base identity. Mutation rate rises specifically with repeat number, peaking around six to eight repeats and then decreasing again. Increased heterozygosity in a population will also increase microsatellite mutation rates, especially when there is a large length difference between alleles. This is likely due to homologous chromosomes with arms of unequal lengths causing instability during meiosis. Many microsatellites are located in non-coding DNA and are biologically silent. Others are located in regulatory or even coding DNA  – microsatellite mutations in such cases can lead to phenotypic changes and diseases. A genome-wide study estimates that microsatellite variation contributes 10–15% of heritable gene expression variation in humans. In mammals, 20–40% of proteins contain repeating sequences of amino acids encoded by short sequence repeats. Most of

12446-600: The mid northern Caucasus area of Russia belong overwhelmingly to the G2a1 subclade based on available samples. The South Ossetians and Svans generally south of North Ossetia have significant number of G2a1 persons, but population percentages have not yet been provided. The presence of the SNP P18 mutation characterizes G2a1a's only subclade, G2a1a. The reliability of both P16 and P18 in identifying everyone in each of these categories has been questioned and individual components of

12573-429: The natural and historical boundary between Europe and Asia. Another opinion is that the rivers Kura and Rioni mark this border, or even that of the river Aras . The Caucasus is a linguistically , culturally and geographically diverse region. The nation states that compose the Caucasus today are the post-Soviet states Georgia (including Adjara and Abkhazia ), Azerbaijan (including Nakhchivan ), Armenia , and

12700-526: The north of the Greater Caucasus range practically impregnable. The mythological Mount Qaf , the world's highest mountain that ancient Iranian lore shrouded in mystery, was said to be situated in this region. The region is also one of the candidates for the location of Airyanem Vaejah , the apparent homeland of the Iranians of Zoroaster . In Middle Persian sources of the Sasanian era, the Caucasus range

12827-518: The northernmost parts of Azerbaijan . The Lesser Caucasus mountain range in the south is occupied by several independent states, mostly by Armenia, Azerbaijan, and Georgia, but also extends to parts of northeastern Turkey , and northern Iran . The region is known for its linguistic diversity : aside from Indo-European and Turkic languages, the Kartvelian , Northwest Caucasian , and Northeast Caucasian language families are indigenous to

12954-607: The notable exception of some yeast species. Microsatellites are distributed throughout the genome. The human genome for example contains 50,000–100,000 dinucleotide microsatellites, and lesser numbers of tri-, tetra- and pentanucleotide microsatellites. Many are located in non-coding parts of the human genome and therefore do not produce proteins, but they can also be located in regulatory regions and coding regions . Microsatellites in non-coding regions may not have any specific function, and therefore might not be selected against; this allows them to accumulate mutations unhindered over

13081-614: The origin of G-M201, most of them in Western Asia . A more eastern origin has also been mentioned, believed by some to originate in an area of the Middle East close to the Himalayan foothills. Nevertheless, in line with the highest diversity of basal branches, a paper by Siiri Rootsi et al. suggested that: "We estimate that the geographic origin of haplogroup G plausibly locates somewhere nearby eastern Anatolia , Armenia or western Iran ." G* (M201) (Subclades here conform to

13208-530: The physical and chemical properties of proteins, with the potential for producing gradual and predictable changes in protein action. For example, length changes in tandemly repeating regions in the Runx2 gene lead to differences in facial length in domesticated dogs ( Canis familiaris ), with an association between longer sequence lengths and longer faces. This association also applies to a wider range of Carnivora species. Length changes in polyalanine tracts within

13335-570: The potentially useful microsatellites are determined, the flanking sequences can be used to design oligonucleotide primers which will amplify the specific microsatellite repeat in a PCR reaction. Random microsatellite primers can be developed by cloning random segments of DNA from the focal species. These random segments are inserted into a plasmid or bacteriophage vector , which is in turn implanted into Escherichia coli bacteria. Colonies are then developed, and screened with fluorescently–labelled oligonucleotide sequences that will hybridize to

13462-511: The presence of specific SNPs or uncommon STR marker oddities. Members of this group have been found in Europe and the Middle East . The next largest subclade of G-P303 is characterized by the presence of the U1 mutation. But a high percentage of U1 men belong to its two subclades, G-L13/S13 and Z1266 (G2a3b1a1b). The G-L13 subclade is most common in north central Europe, and G-Z1266 is most common in

13589-423: The purity of the canonical repeated sequence. A variety of mechanisms for mutation of microsatellite loci have been reviewed, and their resulting polymorphic nature has been quantified. The actual cause of mutations in microsatellites is debated. One proposed cause of such length changes is replication slippage, caused by mismatches between DNA strands while being replicated during meiosis . DNA polymerase ,

13716-532: The replicated segment. With the abundance of PCR technology, primers that flank microsatellite loci are simple and quick to use, but the development of correctly functioning primers is often a tedious and costly process. If searching for microsatellite markers in specific regions of a genome, for example within a particular intron , primers can be designed manually. This involves searching the genomic DNA sequence for microsatellite repeats, which can be done by eye or by using automated tools such as repeat masker . Once

13843-711: The sample and was completely absent in the tested north-western Indian population. In one study, about 6% of the samples from Sri Lanka and Malaysia were reported as haplogroup G, but none were found in the other coastal lands of the Indian Ocean or Pacific Ocean in Asia. G-M201 has been described as "almost absent" and "virtually absent" in India, with the G2a-P15 subclade in particular being considered to be negligible, indicating unique dispersal events from Western Asia. In

13970-445: The short sequence repeats within protein-coding portions of the genome have a repeating unit of three nucleotides, since that length will not cause frame-shifts when mutating. Each trinucleotide repeating sequence is transcribed into a repeating series of the same amino acid. In yeasts, the most common repeated amino acids are glutamine, glutamic acid, asparagine, aspartic acid and serine. Mutations in these repeating segments can affect

14097-723: The southern side, the Lesser Caucasus includes the Javakheti Plateau and the Armenian highlands , part of which is in Turkey. The Caucasus is divided into the North Caucasus and South Caucasus , although the Western Caucasus also exists as a distinct geographic space within the North Caucasus. The Greater Caucasus mountain range in the north is mostly shared by Russia and Georgia as well as

14224-718: The term Caucasus is derived from Caucas ( Georgian : კავკასოსი Ḳavḳasosi ), the son of the Biblical Togarmah and legendary forefather of the Nakh peoples . According to German philologists Otto Schrader and Alfons A. Nehring, the Ancient Greek word Καύκασος ( Kaukasos ) is connected to Gothic hauhs 'high' as well as Lithuanian kaũkas 'hillock' and kaukarà 'hill, top', Russian куча 'heap'. British linguist Adrian Room claims that * kau- also means 'mountain' in Pelasgian , though this

14351-687: The town of Tempio in another study. In the Greek island of Crete , approximately 7% to 11% of males belong to haplogroup G. In north-eastern Croatia , in the town of Osijek , G was found in 14% of the males. The city is on the banks of the river Drava , which notably begins in the Tirol/Tyrol region of the Alps, another haplogroup G focus area in Europe. Farther north, 8% of ethnic Hungarian males and 5.1% of ethnic Bohemian (Czech) males have been found to belong to Haplogroup G. In South Asia , haplogroup G

14478-434: The value of 11 at STR marker DYS490 — a finding rare in other G categories. The L141 mutation is found on the Y chromosome at 2948607. The L141 mutation involves an insertion. G-P303*, also known as G2a2b2a* (previously G2a3b1*), and its subclades are now concentrated in southern Russia and the Caucasus , as well as, at lower levels, other parts of Europe and South West Asia , especially an area including Turkey, Iran and

14605-458: The value of 12 at short tandem repeat (STR) marker DYS392 and all will have the M285 or M342 SNP mutation which characterizes this group. This value of 12 is uncommon in other G categories other than G1. subclades of G1a, G1a1, G1b exist. The highest reported concentration of G1 and its subclades in a single country is in Iran , with next most frequent concentrations in neighboring countries to

14732-651: The very ends of chromosomes and protect the integrity of genomic material (not unlike an aglet on the end of a shoelace) during successive rounds of cell division due to the "end replication problem". In white blood cells, the gradual shortening of telomeric DNA has been shown to inversely correlate with ageing in several sample types. Telomeres consist of repetitive DNA, with the hexanucleotide repeat motif TTAGGG in vertebrates. They are thus classified as minisatellites . Similarly, insects have shorter repeat motifs in their telomeres that could arguably be considered microsatellites. Unlike point mutations , which affect only

14859-515: The west. There are distinctive Ashkenazi Jewish and Kazakh subclades based on STR marker value combinations. Men who belong to this group but are negative for all G2 subclades represent a small number of haplogroup G men. P287 was identified at the University of Arizona and became widely known in late 2007. Its identification caused considerable renaming of G categories. Haplogroup G men who belong to this group, but are negative for all G2a subclades, are uncommon in Europe but may represent

14986-549: The western Caucasus Mountains. The final major subclade is characterized by presence of the SNP Z1903 and by a value of 9 at marker DYS568. A high percentage of G-Z1903 men belong to its subclade, G-Z724. The highest percentage of G-P303 persons in a discrete population so far described is on the island of Ibiza off the eastern Spanish coast. This group has been linked with the Crypto-Jewish population which fled to

15113-641: The workhorse genetic markers for genome-wide scans to locate any gene responsible for a given phenotype or disease, using segregation observations across generations of a sampled pedigree. Although the rise of higher throughput and cost-effective single-nucleotide polymorphism (SNP) platforms led to the era of the SNP for genome scans, microsatellites remain highly informative measures of genomic variation for linkage and association studies. Their continued advantage lies in their greater allelic diversity than biallelic SNPs, thus microsatellites can differentiate alleles within

15240-417: The world community as part of Georgia. The region has many different languages and language families. There are more than 50 ethnic groups living in the region. No fewer than three language families are unique to the area. In addition, Indo-European languages, such as East Slavic , Armenian and Ossetian , and Turkic languages , such as Azerbaijani , Kumyk language and Karachay–Balkar , are spoken in

15367-548: Was S126 (L30), which defines G2a3. G2a was found also in 20 out of 22 samples of ancient Y-DNA from Treilles , the type-site of a Late Neolithic group of farmers in the Southern France , dated to about 5000 years ago. The fourth site also from the same period is the Ötztal Alps where the mummified remains of Ötzi the Iceman were discovered. The Iceman belongs to haplogroup G2a2b (earlier called G2a4). Haplogroup G2a2b

15494-647: Was first identified at Stanford University at chromosome position 21151187, and is a mutation from G to A. The L293 SNP that characterizes a third subclade was identified in June 2010 at Family Tree DNA. It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. The mutation is found on the Y chromosome at 10595022 and is a change from G to C. G-L30 (also G-PF3267, G-S126 or G-U8; G2a2b, previously G2a3) Men who belong to this group but are negative for all its subclades represent

15621-403: Was first identified in samples at 23andMe in 2009 but proved problematic as an individual test, the first successful results being reported at Family Tree DNA in late 2011 under its assigned L223 label. It was then learned that several subclades belong under L223, including: G-L91 was identified in 2009. Its members include " Ötzi ", the so-called Iceman, who died at least 5,000 years BP in

15748-520: Was introduced later, in 1989, by Litt and Luty. The name "satellite" DNA refers to the early observation that centrifugation of genomic DNA in a test tube separates a prominent layer of bulk DNA from accompanying "satellite" layers of repetitive DNA. The increasing availability of DNA amplification by PCR at the beginning of the 1990s triggered a large number of studies using the amplification of microsatellites as genetic markers for forensic medicine, for paternity testing, and for positional cloning to find

15875-594: Was marked by a conflict between Rome and Sassanid Empire for the control of the region. In western Georgia the eastern Roman rule lasted until the Middle Ages. As the Arsacid dynasty of Armenia (an eponymous branch of the Arsacid dynasty of Parthia ) was the first nation to adopt Christianity as state religion (in 301 AD), and Caucasian Albania and Georgia had become Christian entities, Christianity began to overtake Zoroastrianism and pagan beliefs. With

16002-532: Was originally based on the British SGM+ system using 10 loci and a sex marker . The Americans increased this number to 13 loci. The Australian database is called the NCIDD, and since 2013 it has been using 18 core markers for DNA profiling. Microsatellites can be amplified for identification by the polymerase chain reaction (PCR) process, using the unique sequences of flanking regions as primers . DNA

16129-666: Was referred to as Kaf Kof . The term resurfaced in Iranian tradition later on in a variant form when Ferdowsi , in his Shahnameh , referred to the Caucasus mountains as Kōh-i Kāf . "Most of the modern names of the Caucasus originate from the Greek Kaukasos (Lat., Caucasus ) and the Middle Persian Kaf Kof ". "The earliest etymon" of the name Caucasus comes from Kaz-kaz , the Hittite designation of

#300699